EMAIL THIS PAGE TO A FRIEND

GPR33

G protein-coupled receptor 33 (gene/pseudogene)

26 Gene Product Result for
UniProtKB ID: Q49SQ1
Gene ID:
Human(2856) Summary: This gene has been identified as an orphan chemoattractant G-protein-coupled receptors (GPCR) pseudogene. Studies have shown that the inactivated gene is present as the predominant allele in the human population. A small fraction of the human population has been found to harbor an intact allele.[provided by RefSeq, Oct 2010]
Mouse(14762) G protein-coupled receptor 33
Rat(299007) G protein-coupled receptor 33
domestic cat(101087750) G protein-coupled receptor 33
dog(100688257) G protein-coupled receptor 33
cow(788930) G protein-coupled receptor 33
domestic guinea pig(100714644) G protein-coupled receptor 33
naked mole-rat(101698582) G protein-coupled receptor 33
sheep(101102762) G protein-coupled receptor 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008159 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008159 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008159 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031823 Rosetta Predictions rat pricing
NM_008159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120135 predicted 601
2 SASI_Rn01_00120136 predicted 690
3 SASI_Rn01_00120137 predicted 348
4 SASI_Rn01_00120138 predicted 409
5 SASI_Rn01_00120140 predicted 488
6 SASI_Rn01_00120141 predicted 520
7 SASI_Rn01_00120142 predicted 272
8 SASI_Rn01_00120143 predicted 376
9 SASI_Rn01_00120144 predicted 655
10 SASI_Rn02_00203611 predicted 377
11 SASI_Rn01_00120139 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135986 predicted 723
2 SASI_Mm01_00135987 predicted 1116
3 SASI_Mm01_00135988 predicted 628
4 SASI_Mm01_00135989 predicted 741
5 SASI_Mm01_00135990 predicted 358
6 SASI_Mm01_00135991 predicted 959
7 SASI_Mm01_00135992 predicted 530
8 SASI_Mm01_00135994 predicted 609
9 SASI_Mm01_00135995 predicted 300
10 SASI_Mm02_00313263 predicted 471
11 SASI_Mm01_00135993 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008159
GPR33 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 33 (gene/pseudogene)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-1101s1c1
Sequence:CCGGTGCTCTCTTTAACTCAACATTCTCGAGAATGTTGAGTTAAAGAGAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-521s1c1
Sequence:CCGGCCATCAGTGTTGCTCGTTATTCTCGAGAATAACGAGCAACACTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-427s1c1
Sequence:CCGGCAGGACAATCACTGGGTCTTTCTCGAGAAAGACCCAGTGATTGTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-259s1c1
Sequence:CCGGGCTTCTTTGTTCATGGCATTTCTCGAGAAATGCCATGAACAAAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008159
GPR33 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 33 (gene/pseudogene)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-1101s1c1
Sequence:CCGGTGCTCTCTTTAACTCAACATTCTCGAGAATGTTGAGTTAAAGAGAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-521s1c1
Sequence:CCGGCCATCAGTGTTGCTCGTTATTCTCGAGAATAACGAGCAACACTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-427s1c1
Sequence:CCGGCAGGACAATCACTGGGTCTTTCTCGAGAAAGACCCAGTGATTGTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-259s1c1
Sequence:CCGGGCTTCTTTGTTCATGGCATTTCTCGAGAAATGCCATGAACAAAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008159
GPR33 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 33 (gene/pseudogene)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-1101s1c1
Sequence:CCGGTGCTCTCTTTAACTCAACATTCTCGAGAATGTTGAGTTAAAGAGAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-521s1c1
Sequence:CCGGCCATCAGTGTTGCTCGTTATTCTCGAGAATAACGAGCAACACTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-427s1c1
Sequence:CCGGCAGGACAATCACTGGGTCTTTCTCGAGAAAGACCCAGTGATTGTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008159.1-259s1c1
Sequence:CCGGGCTTCTTTGTTCATGGCATTTCTCGAGAAATGCCATGAACAAAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)