EMAIL THIS PAGE TO A FRIEND

GPR34

G protein-coupled receptor 34

108 Gene Product Result for
UniProtKB ID: Q9UPC5, O95853
Gene ID:
Human(2857) Summary: G protein-coupled receptors (GPCRs), such as GPR34, are integral membrane proteins containing 7 putative transmembrane domains (TMs). These proteins mediate signals to the interior of the cell via activation of heterotrimeric G proteins that in turn activate various effector proteins, ultimately resulting in a physiologic response.[supplied by OMIM, Apr 2006]
Mouse(23890) G protein-coupled receptor 34
Rat(554353) G protein-coupled receptor 34
Domestic Rabbit(100352706) G protein-coupled receptor 34
domestic guinea pig(100379274) G protein-coupled receptor 34
chicken(771199) G protein-coupled receptor 34
dog(100683845) G protein-coupled receptor 34
cow(505292) G protein-coupled receptor 34
cow(100139092) G protein-coupled receptor 34
Horse(100050641) G protein-coupled receptor 34
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005300 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046181 MISSION® esiRNA esiRNA human GPR34 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033513 Rosetta Predictions human pricing
NM_001033514 Rosetta Predictions human pricing
NM_001097579 Rosetta Predictions human pricing
NM_005300 Rosetta Predictions human pricing
NM_001024925 Rosetta Predictions rat pricing
NM_011823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194083 predicted 1083
2 SASI_Hs01_00194084 predicted 1025
3 SASI_Hs01_00194085 predicted 1097
4 SASI_Hs01_00194086 predicted 1197
5 SASI_Hs01_00194087 predicted 1154
6 SASI_Hs01_00194088 predicted 1189
7 SASI_Hs01_00194089 predicted 1098
8 SASI_Hs01_00194090 predicted 1020
9 SASI_Hs01_00194091 predicted 1090
10 SASI_Hs01_00194092 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072540 predicted 928
2 SASI_Hs01_00072541 predicted 869
3 SASI_Hs01_00072542 predicted 936
4 SASI_Hs01_00072543 predicted 1035
5 SASI_Hs01_00072544 predicted 997
6 SASI_Hs01_00072545 predicted 1037
7 SASI_Hs01_00072546 predicted 942
8 SASI_Hs01_00072547 predicted 861
9 SASI_Hs01_00072548 predicted 936
10 SASI_Hs01_00072549 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318230 predicted 1076
2 SASI_Hs02_00318231 predicted 1244
3 SASI_Hs02_00318232 predicted 1005
4 SASI_Hs02_00318233 predicted 604
5 SASI_Hs02_00318234 predicted 685
6 SASI_Hs02_00318235 predicted 605
7 SASI_Hs02_00318236 predicted 783
8 SASI_Hs02_00318237 predicted 1486
9 SASI_Hs02_00318238 predicted 1360
10 SASI_Hs02_00318239 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042382 predicted 994
2 SASI_Hs02_00339356 predicted 1167
3 SASI_Hs01_00042383 predicted 927
4 SASI_Hs02_00339357 predicted 533
5 SASI_Hs02_00339358 predicted 611
6 SASI_Hs02_00339359 predicted 533
7 SASI_Hs02_00339360 predicted 709
8 SASI_Hs02_00339361 predicted 1416
9 SASI_Hs02_00339362 predicted 1283
10 SASI_Hs02_00339363 predicted 821
11 SASI_Hs01_00042384 predicted 973
12 SASI_Hs01_00042385 predicted 1079
13 SASI_Hs01_00042386 predicted 1036
14 SASI_Hs01_00042387 predicted 1075
15 SASI_Hs01_00042388 predicted 973
16 SASI_Hs01_00042389 predicted 907
17 SASI_Hs01_00042390 predicted 969
18 SASI_Hs01_00042391 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202811 predicted 855
2 SASI_Rn01_00047427 predicted 508
3 SASI_Rn01_00047428 predicted 684
4 SASI_Rn01_00047429 predicted 472
5 SASI_Rn01_00047431 predicted 986
6 SASI_Rn01_00047432 predicted 319
7 SASI_Rn01_00047433 predicted 881
8 SASI_Rn01_00047434 predicted 1068
9 SASI_Rn01_00047435 predicted 847
10 SASI_Rn01_00047436 predicted 821
11 SASI_Rn01_00047430 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321530 predicted 748
2 SASI_Mm01_00168448 predicted 311
3 SASI_Mm01_00168450 predicted 1329
4 SASI_Mm01_00168451 predicted 1392
5 SASI_Mm02_00321531 predicted 976
6 SASI_Mm01_00168453 predicted 405
7 SASI_Mm01_00168454 predicted 1170
8 SASI_Mm01_00168455 predicted 841
9 SASI_Mm01_00168456 predicted 879
10 SASI_Mm01_00168457 predicted 578
11 SASI_Mm01_00168449 predicted 1282
12 SASI_Mm01_00168452 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011823
GPR34 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 34
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-558s1c1
Sequence:CCGGCCGCATAATGTATCACATCAACTCGAGTTGATGTGATACATTATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-1121s1c1
Sequence:CCGGCCTCTTGTTATTGGAAGGAAACTCGAGTTTCCTTCCAATAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-287s1c1
Sequence:CCGGCCTCTCATGGAATGCACTTTACTCGAGTAAAGTGCATTCCATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-1356s1c1
Sequence:CCGGCCAGTACAGCACTAAGGGTAACTCGAGTTACCCTTAGTGCTGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-924s1c1
Sequence:CCGGCCTACTGATAATCCTCTCATACTCGAGTATGAGAGGATTATCAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011823
GPR34 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 34
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-558s1c1
Sequence:CCGGCCGCATAATGTATCACATCAACTCGAGTTGATGTGATACATTATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-1121s1c1
Sequence:CCGGCCTCTTGTTATTGGAAGGAAACTCGAGTTTCCTTCCAATAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-287s1c1
Sequence:CCGGCCTCTCATGGAATGCACTTTACTCGAGTAAAGTGCATTCCATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-1356s1c1
Sequence:CCGGCCAGTACAGCACTAAGGGTAACTCGAGTTACCCTTAGTGCTGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-924s1c1
Sequence:CCGGCCTACTGATAATCCTCTCATACTCGAGTATGAGAGGATTATCAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011823
GPR34 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 34
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-558s1c1
Sequence:CCGGCCGCATAATGTATCACATCAACTCGAGTTGATGTGATACATTATGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-1121s1c1
Sequence:CCGGCCTCTTGTTATTGGAAGGAAACTCGAGTTTCCTTCCAATAACAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-287s1c1
Sequence:CCGGCCTCTCATGGAATGCACTTTACTCGAGTAAAGTGCATTCCATGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-1356s1c1
Sequence:CCGGCCAGTACAGCACTAAGGGTAACTCGAGTTACCCTTAGTGCTGTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011823.2-924s1c1
Sequence:CCGGCCTACTGATAATCCTCTCATACTCGAGTATGAGAGGATTATCAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005300
GPR34 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 34
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005300.2-1354s1c1
Sequence:CCGGGCCTCTTAATTCTTTGAAGAACTCGAGTTCTTCAAAGAATTAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-234s1c1
Sequence:CCGGCCCACAGAATGCGCTTTATAACTCGAGTTATAAAGCGCATTCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-1054s1c1
Sequence:CCGGGCTAAATGTATCATCTTGCTACTCGAGTAGCAAGATGATACATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-497s1c1
Sequence:CCGGCCTTTCCGAATAATGTATCATCTCGAGATGATACATTATTCGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-662s1c1
Sequence:CCGGCGGAAGGCAATAACAACCAAACTCGAGTTTGGTTGTTATTGCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005300.3-650s21c1
Sequence:CCGGATCAGTTTGGATCGCTATATACTCGAGTATATAGCGATCCAAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005300.3-277s21c1
Sequence:CCGGGCGCTTTATAACCAATCATAGCTCGAGCTATGATTGGTTATAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005300.3-616s21c1
Sequence:CCGGGAACATGTACATTAGCATTATCTCGAGATAATGCTAATGTACATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005300
GPR34 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 34
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005300.2-1354s1c1
Sequence:CCGGGCCTCTTAATTCTTTGAAGAACTCGAGTTCTTCAAAGAATTAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-234s1c1
Sequence:CCGGCCCACAGAATGCGCTTTATAACTCGAGTTATAAAGCGCATTCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-1054s1c1
Sequence:CCGGGCTAAATGTATCATCTTGCTACTCGAGTAGCAAGATGATACATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-497s1c1
Sequence:CCGGCCTTTCCGAATAATGTATCATCTCGAGATGATACATTATTCGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-662s1c1
Sequence:CCGGCGGAAGGCAATAACAACCAAACTCGAGTTTGGTTGTTATTGCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005300.3-650s21c1
Sequence:CCGGATCAGTTTGGATCGCTATATACTCGAGTATATAGCGATCCAAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005300.3-277s21c1
Sequence:CCGGGCGCTTTATAACCAATCATAGCTCGAGCTATGATTGGTTATAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005300.3-616s21c1
Sequence:CCGGGAACATGTACATTAGCATTATCTCGAGATAATGCTAATGTACATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005300
GPR34 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 34
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008882    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005300.2-1354s1c1
Sequence:CCGGGCCTCTTAATTCTTTGAAGAACTCGAGTTCTTCAAAGAATTAAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-234s1c1
Sequence:CCGGCCCACAGAATGCGCTTTATAACTCGAGTTATAAAGCGCATTCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-1054s1c1
Sequence:CCGGGCTAAATGTATCATCTTGCTACTCGAGTAGCAAGATGATACATTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-497s1c1
Sequence:CCGGCCTTTCCGAATAATGTATCATCTCGAGATGATACATTATTCGGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005300.2-662s1c1
Sequence:CCGGCGGAAGGCAATAACAACCAAACTCGAGTTTGGTTGTTATTGCCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005300.3-650s21c1
Sequence:CCGGATCAGTTTGGATCGCTATATACTCGAGTATATAGCGATCCAAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005300.3-277s21c1
Sequence:CCGGGCGCTTTATAACCAATCATAGCTCGAGCTATGATTGGTTATAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005300.3-616s21c1
Sequence:CCGGGAACATGTACATTAGCATTATCTCGAGATAATGCTAATGTACATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks