EMAIL THIS PAGE TO A FRIEND

GPR35

G protein-coupled receptor 35

63 Gene Product Result for
Gene ID:
Mouse(64095) G protein-coupled receptor 35
Rat(367315) G protein-coupled receptor 35
chicken(424833) G protein-coupled receptor 35
domestic cat(101094870) G protein-coupled receptor 35
cow(505056) G protein-coupled receptor 35
dog(486201) G protein-coupled receptor 35
domestic guinea pig(100733055) G protein-coupled receptor 35
naked mole-rat(101704801) G protein-coupled receptor 35
sheep(101103941) G protein-coupled receptor 35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501277 Anti-GPR35 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB2900429 Anti-GPR35 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB2900495 Anti-GPR35 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005301 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005301 Rosetta Predictions human pricing
NM_001037359 Rosetta Predictions rat pricing
NM_001104529 Rosetta Predictions mouse pricing
NM_022320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027917 predicted 1656
2 SASI_Hs02_00339364 predicted 1339
3 SASI_Hs01_00027919 predicted 1595
4 SASI_Hs01_00027920 predicted 1600
5 SASI_Hs01_00027921 predicted 627
6 SASI_Hs01_00027922 predicted 1453
7 SASI_Hs01_00027923 predicted 1588
8 SASI_Hs01_00027924 predicted 626
9 SASI_Hs01_00027925 predicted 824
10 SASI_Hs02_00339365 predicted 867
11 SASI_Hs01_00027918 predicted 1080
12 SASI_Hs01_00027926 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055018 predicted 651
2 SASI_Rn01_00055020 predicted 650
3 SASI_Rn01_00055022 predicted 309
4 SASI_Rn02_00204411 predicted 598
5 SASI_Rn01_00055023 predicted 285
6 SASI_Rn01_00055024 predicted 545
7 SASI_Rn01_00055025 predicted 213
8 SASI_Rn01_00055026 predicted 202
9 SASI_Rn01_00055027 predicted 226
10 SASI_Rn02_00204412 predicted 217
11 SASI_Rn01_00055019 predicted 559
12 SASI_Rn01_00055021 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303266 predicted 953
2 SASI_Mm02_00303267 predicted 1419
3 SASI_Mm02_00303268 predicted 389
4 SASI_Mm02_00303269 predicted 1245
5 SASI_Mm02_00303270 predicted 1278
6 SASI_Mm02_00303271 predicted 1282
7 SASI_Mm02_00303272 predicted 443
8 SASI_Mm02_00303273 predicted 823
9 SASI_Mm02_00303274 predicted 1089
10 SASI_Mm02_00303275 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326551 predicted 1188
2 SASI_Mm01_00069105 predicted 1652
3 SASI_Mm01_00069106 predicted 627
4 SASI_Mm01_00069107 predicted 1487
5 SASI_Mm01_00069109 predicted 1521
6 SASI_Mm02_00326552 predicted 1519
7 SASI_Mm01_00069111 predicted 677
8 SASI_Mm01_00069112 predicted 1058
9 SASI_Mm01_00069113 predicted 1322
10 SASI_Mm02_00326553 predicted 629
11 SASI_Mm01_00069104 predicted 1030
12 SASI_Mm01_00069108 predicted 407
13 SASI_Mm01_00069110 predicted 1089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005301
GPR35 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 35
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005301.2-1388s21c1
Sequence:CCGGGGACGCCATCTGCTACTACTACTCGAGTAGTAGTAGCAGATGGCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005301.2-626s21c1
Sequence:CCGGAGCGATCAAGCTGGGCTTCTACTCGAGTAGAAGCCCAGCTTGATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005301.2-1065s21c1
Sequence:CCGGAGGAGCACCCGGCACAATTTCCTCGAGGAAATTGTGCCGGGTGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005301.2-851s1c1
Sequence:CCGGCCAGGGCATCTACCTGACCAACTCGAGTTGGTCAGGTAGATGCCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005301.2-1073s1c1
Sequence:CCGGCCGGCACAATTTCAACTCCATCTCGAGATGGAGTTGAAATTGTGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005301.2-1391s1c1
Sequence:CCGGCGCCATCTGCTACTACTACATCTCGAGATGTAGTAGTAGCAGATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005301.2-1603s1c1
Sequence:CCGGGCCCTGAACTCACTGTGTATTCTCGAGAATACACAGTGAGTTCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005301
GPR35 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 35
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005301.2-1388s21c1
Sequence:CCGGGGACGCCATCTGCTACTACTACTCGAGTAGTAGTAGCAGATGGCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005301.2-626s21c1
Sequence:CCGGAGCGATCAAGCTGGGCTTCTACTCGAGTAGAAGCCCAGCTTGATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005301.2-1065s21c1
Sequence:CCGGAGGAGCACCCGGCACAATTTCCTCGAGGAAATTGTGCCGGGTGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005301.2-851s1c1
Sequence:CCGGCCAGGGCATCTACCTGACCAACTCGAGTTGGTCAGGTAGATGCCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005301.2-1073s1c1
Sequence:CCGGCCGGCACAATTTCAACTCCATCTCGAGATGGAGTTGAAATTGTGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005301.2-1391s1c1
Sequence:CCGGCGCCATCTGCTACTACTACATCTCGAGATGTAGTAGTAGCAGATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005301.2-1603s1c1
Sequence:CCGGGCCCTGAACTCACTGTGTATTCTCGAGAATACACAGTGAGTTCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005301
GPR35 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 35
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005301.2-1388s21c1
Sequence:CCGGGGACGCCATCTGCTACTACTACTCGAGTAGTAGTAGCAGATGGCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005301.2-626s21c1
Sequence:CCGGAGCGATCAAGCTGGGCTTCTACTCGAGTAGAAGCCCAGCTTGATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005301.2-1065s21c1
Sequence:CCGGAGGAGCACCCGGCACAATTTCCTCGAGGAAATTGTGCCGGGTGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005301.2-851s1c1
Sequence:CCGGCCAGGGCATCTACCTGACCAACTCGAGTTGGTCAGGTAGATGCCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005301.2-1073s1c1
Sequence:CCGGCCGGCACAATTTCAACTCCATCTCGAGATGGAGTTGAAATTGTGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005301.2-1391s1c1
Sequence:CCGGCGCCATCTGCTACTACTACATCTCGAGATGTAGTAGTAGCAGATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005301.2-1603s1c1
Sequence:CCGGGCCCTGAACTCACTGTGTATTCTCGAGAATACACAGTGAGTTCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022320
GPR35 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 35
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-479s1c1
Sequence:CCGGGCCAACAGATACATGAGCATACTCGAGTATGCTCATGTATCTGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-310s1c1
Sequence:CCGGCTGGGTATTCTGCTATCGCATCTCGAGATGCGATAGCAGAATACCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-230s1c1
Sequence:CCGGCCTGCTTCCGTCAACAACTTTCTCGAGAAAGTTGTTGACGGAAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-1000s1c1
Sequence:CCGGCCTGGATGCCATCTGTTACTACTCGAGTAGTAACAGATGGCATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-409s1c1
Sequence:CCGGTGTGCTGTACTCCCTGAAATACTCGAGTATTTCAGGGAGTACAGCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022320
GPR35 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 35
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-479s1c1
Sequence:CCGGGCCAACAGATACATGAGCATACTCGAGTATGCTCATGTATCTGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-310s1c1
Sequence:CCGGCTGGGTATTCTGCTATCGCATCTCGAGATGCGATAGCAGAATACCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-230s1c1
Sequence:CCGGCCTGCTTCCGTCAACAACTTTCTCGAGAAAGTTGTTGACGGAAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-1000s1c1
Sequence:CCGGCCTGGATGCCATCTGTTACTACTCGAGTAGTAACAGATGGCATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-409s1c1
Sequence:CCGGTGTGCTGTACTCCCTGAAATACTCGAGTATTTCAGGGAGTACAGCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022320
GPR35 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 35
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-479s1c1
Sequence:CCGGGCCAACAGATACATGAGCATACTCGAGTATGCTCATGTATCTGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-310s1c1
Sequence:CCGGCTGGGTATTCTGCTATCGCATCTCGAGATGCGATAGCAGAATACCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-230s1c1
Sequence:CCGGCCTGCTTCCGTCAACAACTTTCTCGAGAAAGTTGTTGACGGAAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-1000s1c1
Sequence:CCGGCCTGGATGCCATCTGTTACTACTCGAGTAGTAACAGATGGCATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022320.2-409s1c1
Sequence:CCGGTGTGCTGTACTCCCTGAAATACTCGAGTATTTCAGGGAGTACAGCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)