EMAIL THIS PAGE TO A FRIEND

GPR37

G protein-coupled receptor 37 (endothelin receptor type B-like)

62 Gene Product Result for
Synonyms: EDNRBL PAELR hET(B)R-LP
UniProtKB ID: O15354, O00348, O14768, Q8TD39
Gene ID:
Human(2861) Summary: This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
Mouse(14763) G protein-coupled receptor 37
Rat(117549) G protein-coupled receptor 37
chicken(417748) G protein-coupled receptor 37 (endothelin receptor type B-like)
dog(482275) G protein-coupled receptor 37 (endothelin receptor type B-like)
domestic cat(101096969) G protein-coupled receptor 37 (endothelin receptor type B-like)
cow(532626) G protein-coupled receptor 37 (endothelin receptor type B-like)
Horse(100071585) G protein-coupled receptor 37 (endothelin receptor type B-like)
sheep(101107437) G protein-coupled receptor 37 (endothelin receptor type B-like)
Domestic Rabbit(100356961) G protein-coupled receptor 37 (endothelin receptor type B-like)
domestic guinea pig(100724776) G protein-coupled receptor 37 (endothelin receptor type B-like)
naked mole-rat(101699505) G protein-coupled receptor 37 (endothelin receptor type B-like)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010338 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010338 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010338 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005302 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137411 MISSION® esiRNA esiRNA human GPR37 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005302 Rosetta Predictions human pricing
NM_057201 Rosetta Predictions rat pricing
NM_010338 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168830 predicted 2179
2 SASI_Hs01_00168831 predicted 1651
3 SASI_Hs02_00339366 predicted 1910
4 SASI_Hs02_00339367 predicted 2496
5 SASI_Hs01_00168832 predicted 1740
6 SASI_Hs01_00168833 predicted 1662
7 SASI_Hs01_00168834 predicted 1778
8 SASI_Hs01_00168835 predicted 1701
9 SASI_Hs01_00168836 predicted 1129
10 SASI_Hs01_00168838 predicted 1935
11 SASI_Hs01_00168837 predicted 1896
12 SASI_Hs01_00168839 predicted 2117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120106 predicted 1750
2 SASI_Rn01_00120107 predicted 2150
3 SASI_Rn01_00120109 predicted 1721
4 SASI_Rn01_00120110 predicted 1982
5 SASI_Rn01_00120111 predicted 1598
6 SASI_Rn01_00120112 predicted 1716
7 SASI_Rn01_00120113 predicted 1505
8 SASI_Rn01_00120114 predicted 2116
9 SASI_Rn02_00267152 predicted 2160
10 SASI_Rn02_00267153 predicted 1434
11 SASI_Rn01_00120105 predicted 1765
12 SASI_Rn01_00120108 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147782 predicted 1585
2 SASI_Mm01_00147783 predicted 938
3 SASI_Mm01_00147784 predicted 2112
4 SASI_Mm01_00147785 predicted 1991
5 SASI_Mm01_00147786 predicted 2235
6 SASI_Mm01_00147787 predicted 2149
7 SASI_Mm01_00147788 predicted 1726
8 SASI_Mm01_00147789 predicted 1798
9 SASI_Mm01_00147790 predicted 1855
10 SASI_Mm01_00147791 predicted 1641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010338
VALIDATED
GPR37 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 37 (endothelin receptor type B-like)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010338.1-2809s1c1
Sequence:CCGGGCAAGGAAGATTTGGGCTTTACTCGAGTAAAGCCCAAATCTTCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010338.1-3029s1c1
Sequence:CCGGCCGTGGAAACAAGCGGCAGATCTCGAGATCTGCCGCTTGTTTCCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010338.1-2053s1c1
Sequence:CCGGCCCAACTCTTCTTTCCGACATCTCGAGATGTCGGAAAGAAGAGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010338.1-2696s1c1
Sequence:CCGGCCAGATGTACTATGAAATGATCTCGAGATCATTTCATAGTACATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010338.1-2453s1c1
Sequence:CCGGCGTGTGTCACAATTACTACATCTCGAGATGTAGTAATTGTGACACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010338
VALIDATED
GPR37 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 37 (endothelin receptor type B-like)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010338.1-2809s1c1
Sequence:CCGGGCAAGGAAGATTTGGGCTTTACTCGAGTAAAGCCCAAATCTTCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010338.1-3029s1c1
Sequence:CCGGCCGTGGAAACAAGCGGCAGATCTCGAGATCTGCCGCTTGTTTCCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010338.1-2053s1c1
Sequence:CCGGCCCAACTCTTCTTTCCGACATCTCGAGATGTCGGAAAGAAGAGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010338.1-2696s1c1
Sequence:CCGGCCAGATGTACTATGAAATGATCTCGAGATCATTTCATAGTACATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010338.1-2453s1c1
Sequence:CCGGCGTGTGTCACAATTACTACATCTCGAGATGTAGTAATTGTGACACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010338
VALIDATED
GPR37 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 37 (endothelin receptor type B-like)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010338.1-2809s1c1
Sequence:CCGGGCAAGGAAGATTTGGGCTTTACTCGAGTAAAGCCCAAATCTTCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010338.1-3029s1c1
Sequence:CCGGCCGTGGAAACAAGCGGCAGATCTCGAGATCTGCCGCTTGTTTCCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010338.1-2053s1c1
Sequence:CCGGCCCAACTCTTCTTTCCGACATCTCGAGATGTCGGAAAGAAGAGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010338.1-2696s1c1
Sequence:CCGGCCAGATGTACTATGAAATGATCTCGAGATCATTTCATAGTACATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010338.1-2453s1c1
Sequence:CCGGCGTGTGTCACAATTACTACATCTCGAGATGTAGTAATTGTGACACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005302
VALIDATED
GPR37 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 37 (endothelin receptor type B-like)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-2908s1c1
Sequence:CCGGCTTGGAAGCATTCACAAAGTACTCGAGTACTTTGTGAATGCTTCCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-2238s1c1
Sequence:CCGGCCTTAATATCATCAGCCAGTTCTCGAGAACTGGCTGATGATATTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-1894s1c1
Sequence:CCGGCCGGCAGAAAGGTGCATTATTCTCGAGAATAATGCACCTTTCTGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-2083s1c1
Sequence:CCGGCGAGGGAATAAACGGCAGATTCTCGAGAATCTGCCGTTTATTCCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-1746s1c1
Sequence:CCGGCGTACAGATGTACTACGAAATCTCGAGATTTCGTAGTACATCTGTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005302.2-1651s21c1
Sequence:CCGGTGCAAGATCGTGCCCTATATACTCGAGTATATAGGGCACGATCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005302.2-1971s21c1
Sequence:CCGGTGCGAGACTGTGGTGGTATTTCTCGAGAAATACCACCACAGTCTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005302.2-2439s21c1
Sequence:CCGGCAGTACCATACGCCGTGAAATCTCGAGATTTCACGGCGTATGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005302
VALIDATED
GPR37 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 37 (endothelin receptor type B-like)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-2908s1c1
Sequence:CCGGCTTGGAAGCATTCACAAAGTACTCGAGTACTTTGTGAATGCTTCCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-2238s1c1
Sequence:CCGGCCTTAATATCATCAGCCAGTTCTCGAGAACTGGCTGATGATATTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-1894s1c1
Sequence:CCGGCCGGCAGAAAGGTGCATTATTCTCGAGAATAATGCACCTTTCTGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-2083s1c1
Sequence:CCGGCGAGGGAATAAACGGCAGATTCTCGAGAATCTGCCGTTTATTCCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-1746s1c1
Sequence:CCGGCGTACAGATGTACTACGAAATCTCGAGATTTCGTAGTACATCTGTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005302.2-1651s21c1
Sequence:CCGGTGCAAGATCGTGCCCTATATACTCGAGTATATAGGGCACGATCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005302.2-1971s21c1
Sequence:CCGGTGCGAGACTGTGGTGGTATTTCTCGAGAAATACCACCACAGTCTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005302.2-2439s21c1
Sequence:CCGGCAGTACCATACGCCGTGAAATCTCGAGATTTCACGGCGTATGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005302
VALIDATED
GPR37 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 37 (endothelin receptor type B-like)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008892    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-2908s1c1
Sequence:CCGGCTTGGAAGCATTCACAAAGTACTCGAGTACTTTGTGAATGCTTCCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-2238s1c1
Sequence:CCGGCCTTAATATCATCAGCCAGTTCTCGAGAACTGGCTGATGATATTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-1894s1c1
Sequence:CCGGCCGGCAGAAAGGTGCATTATTCTCGAGAATAATGCACCTTTCTGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-2083s1c1
Sequence:CCGGCGAGGGAATAAACGGCAGATTCTCGAGAATCTGCCGTTTATTCCCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005302.2-1746s1c1
Sequence:CCGGCGTACAGATGTACTACGAAATCTCGAGATTTCGTAGTACATCTGTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005302.2-1651s21c1
Sequence:CCGGTGCAAGATCGTGCCCTATATACTCGAGTATATAGGGCACGATCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005302.2-1971s21c1
Sequence:CCGGTGCGAGACTGTGGTGGTATTTCTCGAGAAATACCACCACAGTCTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005302.2-2439s21c1
Sequence:CCGGCAGTACCATACGCCGTGAAATCTCGAGATTTCACGGCGTATGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)