EMAIL THIS PAGE TO A FRIEND

GPR37L1

G protein-coupled receptor 37 like 1

62 Gene Product Result for
Synonyms: ET(B)R-LP-2 ETBR-LP-2
UniProtKB ID: O60883, Q5SXP7, Q86VP7
Gene ID:
Mouse(171469) G protein-coupled receptor 37-like 1
Rat(252939) G protein-coupled receptor 37-like 1
chicken(421176) G protein-coupled receptor 37 like 1
cow(527572) G protein-coupled receptor 37 like 1
Horse(100052137) G protein-coupled receptor 37 like 1
domestic cat(101097865) G protein-coupled receptor 37 like 1
dog(607285) G protein-coupled receptor 37 like 1
domestic guinea pig(100731313) G protein-coupled receptor 37 like 1
naked mole-rat(101716454) G protein-coupled receptor 37 like 1
sheep(101114457) G protein-coupled receptor 37 like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004767 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001801 MISSION® esiRNA esiRNA targeting human GPR37L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004767 Rosetta Predictions human pricing
XM_001062802 Rosetta Predictions rat pricing
XM_573457 Rosetta Predictions rat pricing
NM_134438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129206 predicted 789
2 SASI_Hs01_00129207 predicted 639
3 SASI_Hs01_00129208 predicted 473
4 SASI_Hs01_00129209 predicted 905
5 SASI_Hs01_00129210 predicted 991
6 SASI_Hs01_00129211 predicted 346
7 SASI_Hs01_00129212 predicted 441
8 SASI_Hs01_00129213 predicted 951
9 SASI_Hs01_00129214 predicted 440
10 SASI_Hs01_00129215 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304657 predicted 254
2 SASI_Rn02_00304658 predicted 732
3 SASI_Rn02_00304659 predicted 251
4 SASI_Rn02_00304660 predicted 726
5 SASI_Rn02_00304661 predicted 905
6 SASI_Rn02_00304662 predicted 1801
7 SASI_Rn02_00304663 predicted 247
8 SASI_Rn02_00304664 predicted 1307
9 SASI_Rn02_00304665 predicted 634
10 SASI_Rn02_00304666 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400334 predicted 731
2 SASI_Rn02_00400335 predicted 507
3 SASI_Rn02_00400336 predicted 333
4 SASI_Rn02_00400337 predicted 566
5 SASI_Rn02_00400338 predicted 819
6 SASI_Rn02_00400339 predicted 648
7 SASI_Rn02_00400340 predicted 602
8 SASI_Rn02_00400341 predicted 627
9 SASI_Rn02_00400342 predicted 527
10 SASI_Rn02_00400343 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339565 predicted 1865
2 SASI_Mm01_00121412 predicted 821
3 SASI_Mm01_00121414 predicted 1790
4 SASI_Mm01_00121415 predicted 1852
5 SASI_Mm01_00121416 predicted 699
6 SASI_Mm02_00339566 predicted 472
7 SASI_Mm01_00121418 predicted 1825
8 SASI_Mm01_00121419 predicted 903
9 SASI_Mm02_00339567 predicted 562
10 SASI_Mm02_00339568 predicted 528
11 SASI_Mm01_00121411 predicted 1685
12 SASI_Mm01_00121413 predicted 470
13 SASI_Mm01_00121417 predicted 1676
14 SASI_Mm01_00121420 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004767
VALIDATED
GPR37L1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 37 like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004767.3-1438s21c1
Sequence:CCGGGTGTCCTCTTCCATCTACTTCCTCGAGGAAGTAGATGGAAGAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004767.3-798s21c1
Sequence:CCGGCCAATCCATCCTGGCCAAGTTCTCGAGAACTTGGCCAGGATGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004767.2-2334s1c1
Sequence:CCGGCCAGAGGATTTCTCTCTCCTTCTCGAGAAGGAGAGAGAAATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004767.2-612s1c1
Sequence:CCGGCCTCCCTATTGTCATCTTCAACTCGAGTTGAAGATGACAATAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004767.2-985s1c1
Sequence:CCGGGCCCGCATGTGGTGGTACTTTCTCGAGAAAGTACCACCACATGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004767.2-1182s1c1
Sequence:CCGGCCCAGAGAACGTCTGCAACATCTCGAGATGTTGCAGACGTTCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004767.2-953s1c1
Sequence:CCGGCCCTGTATTCACTGGTGATGACTCGAGTCATCACCAGTGAATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004767
VALIDATED
GPR37L1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 37 like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004767.3-1438s21c1
Sequence:CCGGGTGTCCTCTTCCATCTACTTCCTCGAGGAAGTAGATGGAAGAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004767.3-798s21c1
Sequence:CCGGCCAATCCATCCTGGCCAAGTTCTCGAGAACTTGGCCAGGATGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004767.2-2334s1c1
Sequence:CCGGCCAGAGGATTTCTCTCTCCTTCTCGAGAAGGAGAGAGAAATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004767.2-612s1c1
Sequence:CCGGCCTCCCTATTGTCATCTTCAACTCGAGTTGAAGATGACAATAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004767.2-985s1c1
Sequence:CCGGGCCCGCATGTGGTGGTACTTTCTCGAGAAAGTACCACCACATGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004767.2-1182s1c1
Sequence:CCGGCCCAGAGAACGTCTGCAACATCTCGAGATGTTGCAGACGTTCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004767.2-953s1c1
Sequence:CCGGCCCTGTATTCACTGGTGATGACTCGAGTCATCACCAGTGAATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004767
VALIDATED
GPR37L1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 37 like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004767.3-1438s21c1
Sequence:CCGGGTGTCCTCTTCCATCTACTTCCTCGAGGAAGTAGATGGAAGAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004767.3-798s21c1
Sequence:CCGGCCAATCCATCCTGGCCAAGTTCTCGAGAACTTGGCCAGGATGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004767.2-2334s1c1
Sequence:CCGGCCAGAGGATTTCTCTCTCCTTCTCGAGAAGGAGAGAGAAATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004767.2-612s1c1
Sequence:CCGGCCTCCCTATTGTCATCTTCAACTCGAGTTGAAGATGACAATAGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004767.2-985s1c1
Sequence:CCGGGCCCGCATGTGGTGGTACTTTCTCGAGAAAGTACCACCACATGCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004767.2-1182s1c1
Sequence:CCGGCCCAGAGAACGTCTGCAACATCTCGAGATGTTGCAGACGTTCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004767.2-953s1c1
Sequence:CCGGCCCTGTATTCACTGGTGATGACTCGAGTCATCACCAGTGAATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134438
GPR37L1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 37 like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-656s1c1
Sequence:CCGGCAATCAATTCTGGCTAAACTACTCGAGTAGTTTAGCCAGAATTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-470s1c1
Sequence:CCGGCTCCCAATTGTCATCTTCAATCTCGAGATTGAAGATGACAATTGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-1039s1c1
Sequence:CCGGCCCTGAGAACGTCTGCAATATCTCGAGATATTGCAGACGTTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-355s1c1
Sequence:CCGGCGTTGGCAATCTGTCTGTCATCTCGAGATGACAGACAGATTGCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-1014s1c1
Sequence:CCGGCTGTGGTCTATGCCTTCTGTACTCGAGTACAGAAGGCATAGACCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134438
GPR37L1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 37 like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-656s1c1
Sequence:CCGGCAATCAATTCTGGCTAAACTACTCGAGTAGTTTAGCCAGAATTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-470s1c1
Sequence:CCGGCTCCCAATTGTCATCTTCAATCTCGAGATTGAAGATGACAATTGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-1039s1c1
Sequence:CCGGCCCTGAGAACGTCTGCAATATCTCGAGATATTGCAGACGTTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-355s1c1
Sequence:CCGGCGTTGGCAATCTGTCTGTCATCTCGAGATGACAGACAGATTGCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-1014s1c1
Sequence:CCGGCTGTGGTCTATGCCTTCTGTACTCGAGTACAGAAGGCATAGACCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134438
GPR37L1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 37 like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-656s1c1
Sequence:CCGGCAATCAATTCTGGCTAAACTACTCGAGTAGTTTAGCCAGAATTGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-470s1c1
Sequence:CCGGCTCCCAATTGTCATCTTCAATCTCGAGATTGAAGATGACAATTGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-1039s1c1
Sequence:CCGGCCCTGAGAACGTCTGCAATATCTCGAGATATTGCAGACGTTCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-355s1c1
Sequence:CCGGCGTTGGCAATCTGTCTGTCATCTCGAGATGACAGACAGATTGCCAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134438.1-1014s1c1
Sequence:CCGGCTGTGGTCTATGCCTTCTGTACTCGAGTACAGAAGGCATAGACCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks