EMAIL THIS PAGE TO A FRIEND

GPR39

G protein-coupled receptor 39

83 Gene Product Result for
UniProtKB ID: O43194, B2RC12, B6V9G4, Q08AS2, Q53R01
Gene ID:
Mouse(71111) G protein-coupled receptor 39
Rat(288995) G protein-coupled receptor 39
Zebrafish(791773) G protein-coupled receptor 39
Horse(100054142) G protein-coupled receptor 39
cow(100139476) G protein-coupled receptor 39
domestic cat(101087678) G protein-coupled receptor 39
chicken(424282) G protein-coupled receptor 39
dog(610696) G protein-coupled receptor 39
sheep(101107933) G protein-coupled receptor 39
Domestic Rabbit(100348896) G protein-coupled receptor 39
domestic guinea pig(100734677) G protein-coupled receptor 39
naked mole-rat(101720338) G protein-coupled receptor 39
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_136205 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136205 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136205 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001508 Rosetta Predictions human pricing
NM_001100943 Rosetta Predictions rat pricing
NM_001114392 Rosetta Predictions rat pricing
XM_222578 Rosetta Predictions rat pricing
XM_913690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332000 predicted 1724
2 SASI_Hs02_00332001 predicted 2098
3 SASI_Hs02_00332002 predicted 2054
4 SASI_Hs02_00332003 predicted 556
5 SASI_Hs02_00332004 predicted 1783
6 SASI_Hs02_00332005 predicted 1751
7 SASI_Hs02_00332006 predicted 1786
8 SASI_Hs02_00332007 predicted 498
9 SASI_Hs02_00332008 predicted 1736
10 SASI_Hs02_00332009 predicted 1737
11 SASI_Hs01_00047105 predicted 880
12 SASI_Hs01_00047106 predicted 313
13 SASI_Hs01_00047107 predicted 258
14 SASI_Hs01_00047108 predicted 205
15 SASI_Hs01_00047109 predicted 384
16 SASI_Hs01_00047110 predicted 323
17 SASI_Hs01_00047111 predicted 228
18 SASI_Hs01_00047112 predicted 201
19 SASI_Hs01_00047113 predicted 658
20 SASI_Hs01_00047114 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210742 predicted 498
2 SASI_Rn02_00210743 predicted 302
3 SASI_Rn02_00210744 predicted 206
4 SASI_Rn02_00210745 predicted 555
5 SASI_Rn02_00210746 predicted 450
6 SASI_Rn02_00210747 predicted 388
7 SASI_Rn02_00210748 predicted 608
8 SASI_Rn02_00210749 predicted 461
9 SASI_Rn02_00210750 predicted 221
10 SASI_Rn02_00210751 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252233 predicted 703
2 SASI_Rn02_00252234 predicted 505
3 SASI_Rn02_00252235 predicted 405
4 SASI_Rn02_00252236 predicted 760
5 SASI_Rn02_00252237 predicted 659
6 SASI_Rn02_00252238 predicted 594
7 SASI_Rn02_00252239 predicted 802
8 SASI_Rn02_00252240 predicted 659
9 SASI_Rn02_00252241 predicted 420
10 SASI_Rn02_00252242 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147744 predicted 983
2 SASI_Rn01_00147745 predicted 834
3 SASI_Rn01_00147746 predicted 1132
4 SASI_Rn01_00147747 predicted 913
5 SASI_Rn01_00147748 predicted 216
6 SASI_Rn01_00147749 predicted 685
7 SASI_Rn01_00147750 predicted 855
8 SASI_Rn01_00147751 predicted 403
9 SASI_Rn01_00147752 predicted 732
10 SASI_Rn01_00147753 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219262 predicted 561
2 SASI_Mm01_00219263 predicted 608
3 SASI_Mm01_00219264 predicted 310
4 SASI_Mm01_00219265 predicted 203
5 SASI_Mm01_00219266 predicted 550
6 SASI_Mm01_00219267 predicted 596
7 SASI_Mm01_00219268 predicted 414
8 SASI_Mm01_00219269 predicted 201
9 SASI_Mm01_00219270 predicted 325
10 SASI_Mm01_00219271 predicted 408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001508
VALIDATED
GPR39 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 39
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001508.1-729s1c1
Sequence:CCGGGAACATGATGCAGGTGCTCATCTCGAGATGAGCACCTGCATCATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001508.1-611s1c1
Sequence:CCGGCCTCCAATATGTCCATCTGTACTCGAGTACAGATGGACATATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001508.1-171s1c1
Sequence:CCGGGCTGCAGAAGAAAGGATACTTCTCGAGAAGTATCCTTTCTTCTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001508.1-108s1c1
Sequence:CCGGGTACCTGATCATCTTCGTGATCTCGAGATCACGAAGATGATCAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001508.1-1204s1c1
Sequence:CCGGGCAAGGAGAACTGAGAAGATTCTCGAGAATCTTCTCAGTTCTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-726s21c1
Sequence:CCGGGCATGCCCATGGAGTTCTACACTCGAGTGTAGAACTCCATGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-1316s21c1
Sequence:CCGGATCTTCCTGAGGCTGATTGTTCTCGAGAACAATCAGCCTCAGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-1078s21c1
Sequence:CCGGGACCTCCAATATGTCCATCTGCTCGAGCAGATGGACATATTGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-495s21c1
Sequence:CCGGGTGACTGCTCCCAAATCATTGCTCGAGCAATGATTTGGGAGCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-978s21c1
Sequence:CCGGTGCTGTTTGCCATGGGTACTGCTCGAGCAGTACCCATGGCAAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-853s21c1
Sequence:CCGGACTCAGCTTTGAGCGCTACATCTCGAGATGTAGCGCTCAAAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001508
VALIDATED
GPR39 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 39
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001508.1-729s1c1
Sequence:CCGGGAACATGATGCAGGTGCTCATCTCGAGATGAGCACCTGCATCATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001508.1-611s1c1
Sequence:CCGGCCTCCAATATGTCCATCTGTACTCGAGTACAGATGGACATATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001508.1-171s1c1
Sequence:CCGGGCTGCAGAAGAAAGGATACTTCTCGAGAAGTATCCTTTCTTCTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001508.1-108s1c1
Sequence:CCGGGTACCTGATCATCTTCGTGATCTCGAGATCACGAAGATGATCAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001508.1-1204s1c1
Sequence:CCGGGCAAGGAGAACTGAGAAGATTCTCGAGAATCTTCTCAGTTCTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-726s21c1
Sequence:CCGGGCATGCCCATGGAGTTCTACACTCGAGTGTAGAACTCCATGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-1316s21c1
Sequence:CCGGATCTTCCTGAGGCTGATTGTTCTCGAGAACAATCAGCCTCAGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-1078s21c1
Sequence:CCGGGACCTCCAATATGTCCATCTGCTCGAGCAGATGGACATATTGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-495s21c1
Sequence:CCGGGTGACTGCTCCCAAATCATTGCTCGAGCAATGATTTGGGAGCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-978s21c1
Sequence:CCGGTGCTGTTTGCCATGGGTACTGCTCGAGCAGTACCCATGGCAAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-853s21c1
Sequence:CCGGACTCAGCTTTGAGCGCTACATCTCGAGATGTAGCGCTCAAAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001508
VALIDATED
GPR39 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 39
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001508.1-729s1c1
Sequence:CCGGGAACATGATGCAGGTGCTCATCTCGAGATGAGCACCTGCATCATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001508.1-611s1c1
Sequence:CCGGCCTCCAATATGTCCATCTGTACTCGAGTACAGATGGACATATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001508.1-171s1c1
Sequence:CCGGGCTGCAGAAGAAAGGATACTTCTCGAGAAGTATCCTTTCTTCTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001508.1-108s1c1
Sequence:CCGGGTACCTGATCATCTTCGTGATCTCGAGATCACGAAGATGATCAGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001508.1-1204s1c1
Sequence:CCGGGCAAGGAGAACTGAGAAGATTCTCGAGAATCTTCTCAGTTCTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-726s21c1
Sequence:CCGGGCATGCCCATGGAGTTCTACACTCGAGTGTAGAACTCCATGGGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-1316s21c1
Sequence:CCGGATCTTCCTGAGGCTGATTGTTCTCGAGAACAATCAGCCTCAGGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-1078s21c1
Sequence:CCGGGACCTCCAATATGTCCATCTGCTCGAGCAGATGGACATATTGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-495s21c1
Sequence:CCGGGTGACTGCTCCCAAATCATTGCTCGAGCAATGATTTGGGAGCAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-978s21c1
Sequence:CCGGTGCTGTTTGCCATGGGTACTGCTCGAGCAGTACCCATGGCAAACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001508.2-853s21c1
Sequence:CCGGACTCAGCTTTGAGCGCTACATCTCGAGATGTAGCGCTCAAAGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136205
GPR39 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 39
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-712s1c1
Sequence:CCGGGTGGCTTTCATGTGTTGGAATCTCGAGATTCCAACACATGAAAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-169s1c1
Sequence:CCGGGTATTGCAGAAGAAGGGCTATCTCGAGATAGCCCTTCTTCTGCAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-524s1c1
Sequence:CCGGGTATCGAGTACCCTCTGGTAACTCGAGTTACCAGAGGGTACTCGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-305s1c1
Sequence:CCGGCCAGCTATGCTCTGTCCTGTACTCGAGTACAGGACAGAGCATAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-153s1c1
Sequence:CCGGCATCAGGGTTACGCAGGTATTCTCGAGAATACCTGCGTAACCCTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136205
GPR39 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 39
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-712s1c1
Sequence:CCGGGTGGCTTTCATGTGTTGGAATCTCGAGATTCCAACACATGAAAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-169s1c1
Sequence:CCGGGTATTGCAGAAGAAGGGCTATCTCGAGATAGCCCTTCTTCTGCAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-524s1c1
Sequence:CCGGGTATCGAGTACCCTCTGGTAACTCGAGTTACCAGAGGGTACTCGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-305s1c1
Sequence:CCGGCCAGCTATGCTCTGTCCTGTACTCGAGTACAGGACAGAGCATAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-153s1c1
Sequence:CCGGCATCAGGGTTACGCAGGTATTCTCGAGAATACCTGCGTAACCCTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136205
GPR39 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 39
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-712s1c1
Sequence:CCGGGTGGCTTTCATGTGTTGGAATCTCGAGATTCCAACACATGAAAGCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-169s1c1
Sequence:CCGGGTATTGCAGAAGAAGGGCTATCTCGAGATAGCCCTTCTTCTGCAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-524s1c1
Sequence:CCGGGTATCGAGTACCCTCTGGTAACTCGAGTTACCAGAGGGTACTCGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-305s1c1
Sequence:CCGGCCAGCTATGCTCTGTCCTGTACTCGAGTACAGGACAGAGCATAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136205.1-153s1c1
Sequence:CCGGCATCAGGGTTACGCAGGTATTCTCGAGAATACCTGCGTAACCCTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks