EMAIL THIS PAGE TO A FRIEND

GPR3

G protein-coupled receptor 3

107 Gene Product Result for
Synonyms: ACCA
UniProtKB ID: P46089, A8K570
Gene ID:
Human(2827) Summary: This gene is a member of the G protein-coupled receptor family and is found in the cell membrane. G protein-coupled receptors, characterized by a seven transmembrane domain motif, are involved in translating outside signals into G protein mediated intracellular effects. The encoded protein activates adenylate cyclase and modulates amyloid-beta production in a mouse model, suggesting that it may play a role in Alzheimer's disease. [provided by RefSeq, Oct 2012]
Mouse(14748) G-protein coupled receptor 3
Rat(266769) G protein-coupled receptor 3
sheep(101112960) G protein-coupled receptor 3
domestic guinea pig(100723548) G protein-coupled receptor 3
naked mole-rat(101701501) G protein-coupled receptor 3
domestic cat(101082583) G protein-coupled receptor 3
cow(540687) G protein-coupled receptor 3
Horse(100070910) G protein-coupled receptor 3
dog(487344) G protein-coupled receptor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005281 Rosetta Predictions human pricing
NM_153727 Rosetta Predictions rat pricing
NM_008154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179460 predicted 217
2 SASI_Hs01_00179461 predicted 488
3 SASI_Hs01_00179462 predicted 548
4 SASI_Hs01_00179463 predicted 1133
5 SASI_Hs01_00179465 predicted 1103
6 SASI_Hs02_00339332 predicted 386
7 SASI_Hs02_00339333 predicted 533
8 SASI_Hs01_00179467 predicted 1085
9 SASI_Hs01_00179468 predicted 675
10 SASI_Hs01_00179469 predicted 1207
11 SASI_Hs01_00179464 predicted 545
12 SASI_Hs01_00179466 predicted 1282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067651 predicted 592
2 SASI_Rn01_00067652 predicted 409
3 SASI_Rn02_00269021 predicted 429
4 SASI_Rn01_00067654 predicted 512
5 SASI_Rn01_00067655 predicted 590
6 SASI_Rn01_00067656 predicted 370
7 SASI_Rn01_00067657 predicted 401
8 SASI_Rn01_00067658 predicted 352
9 SASI_Rn01_00067659 predicted 412
10 SASI_Rn01_00067660 predicted 396
11 SASI_Rn01_00067653 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056555 predicted 733
2 SASI_Mm01_00056556 predicted 516
3 SASI_Mm01_00056557 predicted 1129
4 SASI_Mm01_00056558 predicted 564
5 SASI_Mm01_00056560 predicted 415
6 SASI_Mm01_00056562 predicted 879
7 SASI_Mm01_00056564 predicted 506
8 SASI_Mm02_00313255 predicted 533
9 SASI_Mm02_00313256 predicted 1296
10 SASI_Mm02_00313257 predicted 1093
11 SASI_Mm01_00056559 predicted 864
12 SASI_Mm01_00056561 predicted 1205
13 SASI_Mm01_00056563 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005281
GPR3 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-650s1c1
Sequence:CCGGCGTGGTTTATCCACTCTCCAACTCGAGTTGGAGAGTGGATAAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005281.2-1420s1c1
Sequence:CCGGCGTTTGAATTTCTGAGCTAAACTCGAGTTTAGCTCAGAAATTCAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-918s1c1
Sequence:CCGGCCACCTCTCTACACCTATCTTCTCGAGAAGATAGGTGTAGAGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-495s1c1
Sequence:CCGGCGCTACCTTTCTCTGTACAATCTCGAGATTGTACAGAGAAAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-139s1c1
Sequence:CCGGGCTCAGGCAACGTGAATGTAACTCGAGTTACATTCACGTTGCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005281.2-640s21c1
Sequence:CCGGCCACATGTGGCGTGGTTTATCCTCGAGGATAAACCACGCCACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005281.2-511s21c1
Sequence:CCGGACAATGCCCTCACCTACTATTCTCGAGAATAGTAGGTGAGGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005281.2-1453s21c1
Sequence:CCGGTTAGTCACATAGTTGCCTAAACTCGAGTTTAGGCAACTATGTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005281
GPR3 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-650s1c1
Sequence:CCGGCGTGGTTTATCCACTCTCCAACTCGAGTTGGAGAGTGGATAAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005281.2-1420s1c1
Sequence:CCGGCGTTTGAATTTCTGAGCTAAACTCGAGTTTAGCTCAGAAATTCAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-918s1c1
Sequence:CCGGCCACCTCTCTACACCTATCTTCTCGAGAAGATAGGTGTAGAGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-495s1c1
Sequence:CCGGCGCTACCTTTCTCTGTACAATCTCGAGATTGTACAGAGAAAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-139s1c1
Sequence:CCGGGCTCAGGCAACGTGAATGTAACTCGAGTTACATTCACGTTGCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005281.2-640s21c1
Sequence:CCGGCCACATGTGGCGTGGTTTATCCTCGAGGATAAACCACGCCACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005281.2-511s21c1
Sequence:CCGGACAATGCCCTCACCTACTATTCTCGAGAATAGTAGGTGAGGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005281.2-1453s21c1
Sequence:CCGGTTAGTCACATAGTTGCCTAAACTCGAGTTTAGGCAACTATGTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005281
GPR3 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-650s1c1
Sequence:CCGGCGTGGTTTATCCACTCTCCAACTCGAGTTGGAGAGTGGATAAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005281.2-1420s1c1
Sequence:CCGGCGTTTGAATTTCTGAGCTAAACTCGAGTTTAGCTCAGAAATTCAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-918s1c1
Sequence:CCGGCCACCTCTCTACACCTATCTTCTCGAGAAGATAGGTGTAGAGAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-495s1c1
Sequence:CCGGCGCTACCTTTCTCTGTACAATCTCGAGATTGTACAGAGAAAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005281.2-139s1c1
Sequence:CCGGGCTCAGGCAACGTGAATGTAACTCGAGTTACATTCACGTTGCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005281.2-640s21c1
Sequence:CCGGCCACATGTGGCGTGGTTTATCCTCGAGGATAAACCACGCCACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005281.2-511s21c1
Sequence:CCGGACAATGCCCTCACCTACTATTCTCGAGAATAGTAGGTGAGGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005281.2-1453s21c1
Sequence:CCGGTTAGTCACATAGTTGCCTAAACTCGAGTTTAGGCAACTATGTGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008154
GPR3 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-1322s1c1
Sequence:CCGGCCCGTCTCTACACCTATCTTACTCGAGTAAGATAGGTGTAGAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-1437s1c1
Sequence:CCGGCTGCTGTTCCACTTCCAAGATCTCGAGATCTTGGAAGTGGAACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-954s1c1
Sequence:CCGGGACTTATGTGATGCTGGCCTTCTCGAGAAGGCCAGCATCACATAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-908s1c1
Sequence:CCGGCCCTGTACAATGCTCTCACTTCTCGAGAAGTGAGAGCATTGTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008154.1-1507s1c1
Sequence:CCGGCCTGTGGCTTTGACTACTATACTCGAGTATAGTAGTCAAAGCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008154.3-1167s21c1
Sequence:CCGGTAGGTCCACCAGGGCTTAATTCTCGAGAATTAAGCCCTGGTGGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-555s21c1
Sequence:CCGGCTACTCAGAGACAACGGTAACCTCGAGGTTACCGTTGTCTCTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-743s21c1
Sequence:CCGGGCATCATGTTGCAGCTCTATGCTCGAGCATAGAGCTGCAACATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-1101s21c1
Sequence:CCGGCCCTAGTGATGTCTAGTTTCACTCGAGTGAAACTAGACATCACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-1010s21c1
Sequence:CCGGTCTACGCCTTTCGCAACCAAGCTCGAGCTTGGTTGCGAAAGGCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008154
GPR3 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-1322s1c1
Sequence:CCGGCCCGTCTCTACACCTATCTTACTCGAGTAAGATAGGTGTAGAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-1437s1c1
Sequence:CCGGCTGCTGTTCCACTTCCAAGATCTCGAGATCTTGGAAGTGGAACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-954s1c1
Sequence:CCGGGACTTATGTGATGCTGGCCTTCTCGAGAAGGCCAGCATCACATAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-908s1c1
Sequence:CCGGCCCTGTACAATGCTCTCACTTCTCGAGAAGTGAGAGCATTGTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008154.1-1507s1c1
Sequence:CCGGCCTGTGGCTTTGACTACTATACTCGAGTATAGTAGTCAAAGCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008154.3-1167s21c1
Sequence:CCGGTAGGTCCACCAGGGCTTAATTCTCGAGAATTAAGCCCTGGTGGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-555s21c1
Sequence:CCGGCTACTCAGAGACAACGGTAACCTCGAGGTTACCGTTGTCTCTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-743s21c1
Sequence:CCGGGCATCATGTTGCAGCTCTATGCTCGAGCATAGAGCTGCAACATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-1101s21c1
Sequence:CCGGCCCTAGTGATGTCTAGTTTCACTCGAGTGAAACTAGACATCACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-1010s21c1
Sequence:CCGGTCTACGCCTTTCGCAACCAAGCTCGAGCTTGGTTGCGAAAGGCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008154
GPR3 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-1322s1c1
Sequence:CCGGCCCGTCTCTACACCTATCTTACTCGAGTAAGATAGGTGTAGAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-1437s1c1
Sequence:CCGGCTGCTGTTCCACTTCCAAGATCTCGAGATCTTGGAAGTGGAACAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-954s1c1
Sequence:CCGGGACTTATGTGATGCTGGCCTTCTCGAGAAGGCCAGCATCACATAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008154.1-908s1c1
Sequence:CCGGCCCTGTACAATGCTCTCACTTCTCGAGAAGTGAGAGCATTGTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008154.1-1507s1c1
Sequence:CCGGCCTGTGGCTTTGACTACTATACTCGAGTATAGTAGTCAAAGCCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008154.3-1167s21c1
Sequence:CCGGTAGGTCCACCAGGGCTTAATTCTCGAGAATTAAGCCCTGGTGGACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-555s21c1
Sequence:CCGGCTACTCAGAGACAACGGTAACCTCGAGGTTACCGTTGTCTCTGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-743s21c1
Sequence:CCGGGCATCATGTTGCAGCTCTATGCTCGAGCATAGAGCTGCAACATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-1101s21c1
Sequence:CCGGCCCTAGTGATGTCTAGTTTCACTCGAGTGAAACTAGACATCACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008154.3-1010s21c1
Sequence:CCGGTCTACGCCTTTCGCAACCAAGCTCGAGCTTGGTTGCGAAAGGCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks