EMAIL THIS PAGE TO A FRIEND

GPR42

G protein-coupled receptor 42 (gene/pseudogene)

17 Gene Product Result for
Synonyms: FFAR1L FFAR3L GPR41L GPR42P
Species: Human GPR42(2866)
UniProtKB ID: O15529
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005305 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126841 MISSION® esiRNA esiRNA human GPR42P (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005305 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044160 predicted 265
2 SASI_Hs01_00044161 predicted 577
3 SASI_Hs01_00044162 predicted 442
4 SASI_Hs01_00044163 predicted 500
5 SASI_Hs01_00044164 predicted 490
6 SASI_Hs01_00044165 predicted 285
7 SASI_Hs01_00044166 predicted 420
8 SASI_Hs01_00044168 predicted 575
9 SASI_Hs01_00044169 predicted 579
10 SASI_Hs02_00339371 predicted 323
11 SASI_Hs01_00044167 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005305
GPR42 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 42 (gene/pseudogene)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-264s1c1
Sequence:CCGGCCCACTCTCTGGATTCATCTTCTCGAGAAGATGAATCCAGAGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-694s1c1
Sequence:CCGGCTCAACTTCCTTGTCTGCTTTCTCGAGAAAGCAGACAAGGAAGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-189s1c1
Sequence:CCGGCCTGCTGCTGTTCCTGCCTTTCTCGAGAAAGGCAGGAACAGCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-279s1c1
Sequence:CCGGCATCTTCTTCACCACCATCTACTCGAGTAGATGGTGGTGAAGAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-740s1c1
Sequence:CCGGTGGGCTATATCTGCGGTGAAACTCGAGTTTCACCGCAGATATAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-55s21c1
Sequence:CCGGTCGGTGTACCTTCTCACTTTCCTCGAGGAAAGTGAGAAGGTACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-442s21c1
Sequence:CCGGAGCGTGGTCTACGTCATAGAACTCGAGTTCTATGACGTAGACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-729s21c1
Sequence:CCGGGTCCCATGTCGTGGGCTATATCTCGAGATATAGCCCACGACATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-560s21c1
Sequence:CCGGAGATGGCTGTGGTCCTCTTTGCTCGAGCAAAGAGGACCACAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-281s21c1
Sequence:CCGGTCTTCTTCACCACCATCTATCCTCGAGGATAGATGGTGGTGAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005305
GPR42 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 42 (gene/pseudogene)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-264s1c1
Sequence:CCGGCCCACTCTCTGGATTCATCTTCTCGAGAAGATGAATCCAGAGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-694s1c1
Sequence:CCGGCTCAACTTCCTTGTCTGCTTTCTCGAGAAAGCAGACAAGGAAGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-189s1c1
Sequence:CCGGCCTGCTGCTGTTCCTGCCTTTCTCGAGAAAGGCAGGAACAGCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-279s1c1
Sequence:CCGGCATCTTCTTCACCACCATCTACTCGAGTAGATGGTGGTGAAGAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-740s1c1
Sequence:CCGGTGGGCTATATCTGCGGTGAAACTCGAGTTTCACCGCAGATATAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-55s21c1
Sequence:CCGGTCGGTGTACCTTCTCACTTTCCTCGAGGAAAGTGAGAAGGTACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-442s21c1
Sequence:CCGGAGCGTGGTCTACGTCATAGAACTCGAGTTCTATGACGTAGACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-729s21c1
Sequence:CCGGGTCCCATGTCGTGGGCTATATCTCGAGATATAGCCCACGACATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-560s21c1
Sequence:CCGGAGATGGCTGTGGTCCTCTTTGCTCGAGCAAAGAGGACCACAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-281s21c1
Sequence:CCGGTCTTCTTCACCACCATCTATCCTCGAGGATAGATGGTGGTGAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005305
GPR42 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 42 (gene/pseudogene)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-264s1c1
Sequence:CCGGCCCACTCTCTGGATTCATCTTCTCGAGAAGATGAATCCAGAGAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-694s1c1
Sequence:CCGGCTCAACTTCCTTGTCTGCTTTCTCGAGAAAGCAGACAAGGAAGTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-189s1c1
Sequence:CCGGCCTGCTGCTGTTCCTGCCTTTCTCGAGAAAGGCAGGAACAGCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-279s1c1
Sequence:CCGGCATCTTCTTCACCACCATCTACTCGAGTAGATGGTGGTGAAGAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005305.1-740s1c1
Sequence:CCGGTGGGCTATATCTGCGGTGAAACTCGAGTTTCACCGCAGATATAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-55s21c1
Sequence:CCGGTCGGTGTACCTTCTCACTTTCCTCGAGGAAAGTGAGAAGGTACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-442s21c1
Sequence:CCGGAGCGTGGTCTACGTCATAGAACTCGAGTTCTATGACGTAGACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-729s21c1
Sequence:CCGGGTCCCATGTCGTGGGCTATATCTCGAGATATAGCCCACGACATGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-560s21c1
Sequence:CCGGAGATGGCTGTGGTCCTCTTTGCTCGAGCAAAGAGGACCACAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005305.1-281s21c1
Sequence:CCGGTCTTCTTCACCACCATCTATCCTCGAGGATAGATGGTGGTGAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks