EMAIL THIS PAGE TO A FRIEND

GPR45

G protein-coupled receptor 45

54 Gene Product Result for
Synonyms: PSP24 PSP24(ALPHA) PSP24A
UniProtKB ID: Q9Y5Y3, Q6NWS4, Q6NXU6
Gene ID:
Human(11250) Summary: This intronless gene encodes a member of the G protein-coupled receptor (GPCR) family. Members of this protein family contain seven putative transmembrane domains and may mediate signaling processes to the interior of the cell via activation of heterotrimeric G proteins. This protein may function in the central nervous system. [provided by RefSeq, Jul 2008]
Mouse(93690) G protein-coupled receptor 45
Rat(301372) G protein-coupled receptor 45
domestic guinea pig(100731660) G protein-coupled receptor 45
naked mole-rat(101717624) G protein-coupled receptor 45
sheep(101123617) G protein-coupled receptor 45
dog(481321) G protein-coupled receptor 45
domestic cat(101100881) G protein-coupled receptor 45
cow(510657) G protein-coupled receptor 45
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007227 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019201 MISSION® esiRNA esiRNA targeting human GPR45 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007227 Rosetta Predictions human pricing
NM_001106906 Rosetta Predictions rat pricing
NM_053107 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024400 predicted 263
2 SASI_Hs01_00024401 predicted 1334
3 SASI_Hs01_00024402 predicted 1453
4 SASI_Hs01_00024403 predicted 976
5 SASI_Hs01_00024404 predicted 1347
6 SASI_Hs01_00024405 predicted 1312
7 SASI_Hs01_00024406 predicted 1464
8 SASI_Hs01_00024407 predicted 1174
9 SASI_Hs01_00024408 predicted 270
10 SASI_Hs01_00024409 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223566 predicted 1657
2 SASI_Rn02_00223567 predicted 1425
3 SASI_Rn02_00223568 predicted 475
4 SASI_Rn02_00223569 predicted 1467
5 SASI_Rn02_00223570 predicted 876
6 SASI_Rn02_00223571 predicted 1354
7 SASI_Rn02_00223572 predicted 1482
8 SASI_Rn02_00223573 predicted 1320
9 SASI_Rn02_00223574 predicted 1518
10 SASI_Rn02_00223575 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027107 predicted 789
2 SASI_Mm01_00027108 predicted 746
3 SASI_Mm01_00027109 predicted 764
4 SASI_Mm01_00027110 predicted 831
5 SASI_Mm01_00027111 predicted 669
6 SASI_Mm01_00027112 predicted 1141
7 SASI_Mm01_00027113 predicted 1152
8 SASI_Mm01_00027114 predicted 1479
9 SASI_Mm01_00027115 predicted 843
10 SASI_Mm01_00027116 predicted 1383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053107
GPR45 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 45
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-755s1c1
Sequence:CCGGCCGACATCATGCTGTCTTTATCTCGAGATAAAGACAGCATGATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-1546s1c1
Sequence:CCGGACTTTCCAAATCCTCCCTAAACTCGAGTTTAGGGAGGATTTGGAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-1407s1c1
Sequence:CCGGGTTCTATTACAGCGCCTCCTTCTCGAGAAGGAGGCGCTGTAATAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-1604s1c1
Sequence:CCGGCCATCTATGTGTGCAACGAAACTCGAGTTTCGTTGCACACATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-615s1c1
Sequence:CCGGGCTCAGGATCTCGCTGGCAATCTCGAGATTGCCAGCGAGATCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053107
GPR45 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 45
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-755s1c1
Sequence:CCGGCCGACATCATGCTGTCTTTATCTCGAGATAAAGACAGCATGATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-1546s1c1
Sequence:CCGGACTTTCCAAATCCTCCCTAAACTCGAGTTTAGGGAGGATTTGGAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-1407s1c1
Sequence:CCGGGTTCTATTACAGCGCCTCCTTCTCGAGAAGGAGGCGCTGTAATAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-1604s1c1
Sequence:CCGGCCATCTATGTGTGCAACGAAACTCGAGTTTCGTTGCACACATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-615s1c1
Sequence:CCGGGCTCAGGATCTCGCTGGCAATCTCGAGATTGCCAGCGAGATCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053107
GPR45 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 45
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-755s1c1
Sequence:CCGGCCGACATCATGCTGTCTTTATCTCGAGATAAAGACAGCATGATGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-1546s1c1
Sequence:CCGGACTTTCCAAATCCTCCCTAAACTCGAGTTTAGGGAGGATTTGGAAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-1407s1c1
Sequence:CCGGGTTCTATTACAGCGCCTCCTTCTCGAGAAGGAGGCGCTGTAATAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-1604s1c1
Sequence:CCGGCCATCTATGTGTGCAACGAAACTCGAGTTTCGTTGCACACATAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053107.2-615s1c1
Sequence:CCGGGCTCAGGATCTCGCTGGCAATCTCGAGATTGCCAGCGAGATCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007227
GPR45 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 45
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007227.3-1349s1c1
Sequence:CCGGGCACAAAGGTACTCATTTGTACTCGAGTACAAATGAGTACCTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-1194s1c1
Sequence:CCGGAGCACAGTCTACGTGTGCAATCTCGAGATTGCACACGTAGACTGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-743s1c1
Sequence:CCGGCGTCATGCTGTGCGCCTACATCTCGAGATGTAGGCGCACAGCATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-1082s1c1
Sequence:CCGGCGTCTACTGCTGGAGAATCAACTCGAGTTGATTCTCCAGCAGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-229s1c1
Sequence:CCGGCCATAGTGATGCTGCTGATGACTCGAGTCATCAGCAGCATCACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007227.3-1055s21c1
Sequence:CCGGTTACCTCAAGTCCGTCTTCAACTCGAGTTGAAGACGGACTTGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007227.3-1328s21c1
Sequence:CCGGCACTTTGTGGTGGCAATTTAACTCGAGTTAAATTGCCACCACAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007227.3-745s21c1
Sequence:CCGGTCATGCTGTGCGCCTACATGTCTCGAGACATGTAGGCGCACAGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007227
GPR45 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 45
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007227.3-1349s1c1
Sequence:CCGGGCACAAAGGTACTCATTTGTACTCGAGTACAAATGAGTACCTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-1194s1c1
Sequence:CCGGAGCACAGTCTACGTGTGCAATCTCGAGATTGCACACGTAGACTGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-743s1c1
Sequence:CCGGCGTCATGCTGTGCGCCTACATCTCGAGATGTAGGCGCACAGCATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-1082s1c1
Sequence:CCGGCGTCTACTGCTGGAGAATCAACTCGAGTTGATTCTCCAGCAGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-229s1c1
Sequence:CCGGCCATAGTGATGCTGCTGATGACTCGAGTCATCAGCAGCATCACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007227.3-1055s21c1
Sequence:CCGGTTACCTCAAGTCCGTCTTCAACTCGAGTTGAAGACGGACTTGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007227.3-1328s21c1
Sequence:CCGGCACTTTGTGGTGGCAATTTAACTCGAGTTAAATTGCCACCACAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007227.3-745s21c1
Sequence:CCGGTCATGCTGTGCGCCTACATGTCTCGAGACATGTAGGCGCACAGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007227
GPR45 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 45
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007227.3-1349s1c1
Sequence:CCGGGCACAAAGGTACTCATTTGTACTCGAGTACAAATGAGTACCTTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-1194s1c1
Sequence:CCGGAGCACAGTCTACGTGTGCAATCTCGAGATTGCACACGTAGACTGTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-743s1c1
Sequence:CCGGCGTCATGCTGTGCGCCTACATCTCGAGATGTAGGCGCACAGCATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-1082s1c1
Sequence:CCGGCGTCTACTGCTGGAGAATCAACTCGAGTTGATTCTCCAGCAGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007227.3-229s1c1
Sequence:CCGGCCATAGTGATGCTGCTGATGACTCGAGTCATCAGCAGCATCACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007227.3-1055s21c1
Sequence:CCGGTTACCTCAAGTCCGTCTTCAACTCGAGTTGAAGACGGACTTGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007227.3-1328s21c1
Sequence:CCGGCACTTTGTGGTGGCAATTTAACTCGAGTTAAATTGCCACCACAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007227.3-745s21c1
Sequence:CCGGTCATGCTGTGCGCCTACATGTCTCGAGACATGTAGGCGCACAGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks