EMAIL THIS PAGE TO A FRIEND

GPR4

G protein-coupled receptor 4

54 Gene Product Result for
UniProtKB ID: P46093, A8K3T3, B0M0K1, Q6NWM4
Gene ID:
Mouse(319197) G protein-coupled receptor 4
Rat(308408) G protein-coupled receptor 4
naked mole-rat(101707568) G protein-coupled receptor 4
sheep(101113876) G protein-coupled receptor 4
Domestic Rabbit(100347205) G protein-coupled receptor 4
dog(484440) G protein-coupled receptor 4
cow(512876) G protein-coupled receptor 4
domestic cat(101094554) G protein-coupled receptor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005282 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005282 Rosetta Predictions human pricing
NM_001025680 Rosetta Predictions rat pricing
NM_175668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057003 predicted 853
2 SASI_Hs02_00339334 predicted 858
3 SASI_Hs01_00057005 predicted 1508
4 SASI_Hs01_00057007 predicted 730
5 SASI_Hs01_00057008 predicted 1306
6 SASI_Hs01_00057009 predicted 1169
7 SASI_Hs01_00057010 predicted 1122
8 SASI_Hs01_00057011 predicted 1078
9 SASI_Hs01_00057012 predicted 1362
10 SASI_Hs02_00339335 predicted 1053
11 SASI_Hs01_00057004 predicted 641
12 SASI_Hs01_00057006 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045150 predicted 442
2 SASI_Rn01_00045151 predicted 831
3 SASI_Rn02_00203286 predicted 357
4 SASI_Rn01_00045152 predicted 784
5 SASI_Rn01_00045153 predicted 1012
6 SASI_Rn01_00045154 predicted 1155
7 SASI_Rn01_00045155 predicted 982
8 SASI_Rn01_00045156 predicted 748
9 SASI_Rn01_00045157 predicted 740
10 SASI_Rn01_00045158 predicted 766
11 SASI_Rn01_00045159 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156517 predicted 1452
2 SASI_Mm01_00156518 predicted 1140
3 SASI_Mm01_00156519 predicted 1415
4 SASI_Mm01_00156520 predicted 1406
5 SASI_Mm01_00156521 predicted 1509
6 SASI_Mm01_00156522 predicted 2316
7 SASI_Mm01_00156523 predicted 1569
8 SASI_Mm01_00156524 predicted 1223
9 SASI_Mm02_00346604 predicted 1065
10 SASI_Mm01_00156516 predicted 1808
11 SASI_Mm01_00156525 predicted 1684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175668
GPR4 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175668.4-2216s21c1
Sequence:CCGGGCTTGGTTTCTGGCAGATAAGCTCGAGCTTATCTGCCAGAAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175668.4-2314s21c1
Sequence:CCGGAGACCCACTTGGACCACAAAGCTCGAGCTTTGTGGTCCAAGTGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-1059s1c1
Sequence:CCGGCCTGCTGTACATCTGCACTTTCTCGAGAAAGTGCAGATGTACAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175668.2-2294s1c1
Sequence:CCGGCCGAGGAAAGATTTGGAAGTTCTCGAGAACTTCCAAATCTTTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-1517s1c1
Sequence:CCGGGCCAGGAGAAAGTCAAGATCACTCGAGTGATCTTGACTTTCTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-1410s1c1
Sequence:CCGGGATGAATCTGTACCGCGTCTTCTCGAGAAGACGCGGTACAGATTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-924s1c1
Sequence:CCGGCTTCCCACCATCTCTCTACATCTCGAGATGTAGAGAGATGGTGGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175668
GPR4 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175668.4-2216s21c1
Sequence:CCGGGCTTGGTTTCTGGCAGATAAGCTCGAGCTTATCTGCCAGAAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175668.4-2314s21c1
Sequence:CCGGAGACCCACTTGGACCACAAAGCTCGAGCTTTGTGGTCCAAGTGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-1059s1c1
Sequence:CCGGCCTGCTGTACATCTGCACTTTCTCGAGAAAGTGCAGATGTACAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175668.2-2294s1c1
Sequence:CCGGCCGAGGAAAGATTTGGAAGTTCTCGAGAACTTCCAAATCTTTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-1517s1c1
Sequence:CCGGGCCAGGAGAAAGTCAAGATCACTCGAGTGATCTTGACTTTCTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-1410s1c1
Sequence:CCGGGATGAATCTGTACCGCGTCTTCTCGAGAAGACGCGGTACAGATTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-924s1c1
Sequence:CCGGCTTCCCACCATCTCTCTACATCTCGAGATGTAGAGAGATGGTGGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175668
GPR4 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446327    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175668.4-2216s21c1
Sequence:CCGGGCTTGGTTTCTGGCAGATAAGCTCGAGCTTATCTGCCAGAAACCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175668.4-2314s21c1
Sequence:CCGGAGACCCACTTGGACCACAAAGCTCGAGCTTTGTGGTCCAAGTGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-1059s1c1
Sequence:CCGGCCTGCTGTACATCTGCACTTTCTCGAGAAAGTGCAGATGTACAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175668.2-2294s1c1
Sequence:CCGGCCGAGGAAAGATTTGGAAGTTCTCGAGAACTTCCAAATCTTTCCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-1517s1c1
Sequence:CCGGGCCAGGAGAAAGTCAAGATCACTCGAGTGATCTTGACTTTCTCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-1410s1c1
Sequence:CCGGGATGAATCTGTACCGCGTCTTCTCGAGAAGACGCGGTACAGATTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175668.2-924s1c1
Sequence:CCGGCTTCCCACCATCTCTCTACATCTCGAGATGTAGAGAGATGGTGGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005282
GPR4 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005282.2-1226s21c1
Sequence:CCGGGGTTCATCTTCTACACCAATACTCGAGTATTGGTGTAGAAGATGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005282.2-2240s21c1
Sequence:CCGGCTGAAGGAGGAGATGAGTAAACTCGAGTTTACTCATCTCCTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005282.2-1478s21c1
Sequence:CCGGTGGCCTGGATGAACCTCTATCCTCGAGGATAGAGGTTCATCCAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005282.2-2124s21c1
Sequence:CCGGGGGCTGTGTTAATATTCATAACTCGAGTTATGAATATTAACACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-1293s1c1
Sequence:CCGGCTGGTCTGCTTTGCGCCCTATCTCGAGATAGGGCGCAAAGCAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-887s1c1
Sequence:CCGGCACCAATATCTACATCAGCATCTCGAGATGCTGATGTAGATATTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-1133s1c1
Sequence:CCGGGATGAACCTCTATCGGGTGTTCTCGAGAACACCCGATAGAGGTTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-875s1c1
Sequence:CCGGGTTCATCTTCTACACCAATATCTCGAGATATTGGTGTAGAAGATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005282.1-2162s1c1
Sequence:CCGGCCTCCCAAAGTGCTCAGATTACTCGAGTAATCTGAGCACTTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005282
GPR4 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005282.2-1226s21c1
Sequence:CCGGGGTTCATCTTCTACACCAATACTCGAGTATTGGTGTAGAAGATGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005282.2-2240s21c1
Sequence:CCGGCTGAAGGAGGAGATGAGTAAACTCGAGTTTACTCATCTCCTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005282.2-1478s21c1
Sequence:CCGGTGGCCTGGATGAACCTCTATCCTCGAGGATAGAGGTTCATCCAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005282.2-2124s21c1
Sequence:CCGGGGGCTGTGTTAATATTCATAACTCGAGTTATGAATATTAACACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-1293s1c1
Sequence:CCGGCTGGTCTGCTTTGCGCCCTATCTCGAGATAGGGCGCAAAGCAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-887s1c1
Sequence:CCGGCACCAATATCTACATCAGCATCTCGAGATGCTGATGTAGATATTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-1133s1c1
Sequence:CCGGGATGAACCTCTATCGGGTGTTCTCGAGAACACCCGATAGAGGTTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-875s1c1
Sequence:CCGGGTTCATCTTCTACACCAATATCTCGAGATATTGGTGTAGAAGATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005282.1-2162s1c1
Sequence:CCGGCCTCCCAAAGTGCTCAGATTACTCGAGTAATCTGAGCACTTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005282
GPR4 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005282.2-1226s21c1
Sequence:CCGGGGTTCATCTTCTACACCAATACTCGAGTATTGGTGTAGAAGATGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005282.2-2240s21c1
Sequence:CCGGCTGAAGGAGGAGATGAGTAAACTCGAGTTTACTCATCTCCTCCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005282.2-1478s21c1
Sequence:CCGGTGGCCTGGATGAACCTCTATCCTCGAGGATAGAGGTTCATCCAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005282.2-2124s21c1
Sequence:CCGGGGGCTGTGTTAATATTCATAACTCGAGTTATGAATATTAACACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-1293s1c1
Sequence:CCGGCTGGTCTGCTTTGCGCCCTATCTCGAGATAGGGCGCAAAGCAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-887s1c1
Sequence:CCGGCACCAATATCTACATCAGCATCTCGAGATGCTGATGTAGATATTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-1133s1c1
Sequence:CCGGGATGAACCTCTATCGGGTGTTCTCGAGAACACCCGATAGAGGTTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005282.1-875s1c1
Sequence:CCGGGTTCATCTTCTACACCAATATCTCGAGATATTGGTGTAGAAGATGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011570    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005282.1-2162s1c1
Sequence:CCGGCCTCCCAAAGTGCTCAGATTACTCGAGTAATCTGAGCACTTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks