EMAIL THIS PAGE TO A FRIEND

GPR50

G protein-coupled receptor 50

66 Gene Product Result for
Synonyms: H9 Mel1c
UniProtKB ID: Q13585, Q0VGG3, Q3ZAR0
Gene ID:
Human(9248) Summary: This gene product belongs to the G-protein coupled receptor 1 family. Even though this protein shares similarity with the melatonin receptors, it does not bind melatonin, however, it inhibits melatonin receptor 1A function through heterodimerization. Polymorphic variants of this gene have been associated with bipolar affective disorder in women. [provided by RefSeq, Jan 2010]
Mouse(14765) G-protein-coupled receptor 50
Rat(117097) G protein-coupled receptor 50
dog(492213) G protein-coupled receptor 50
domestic cat(101094577) G protein-coupled receptor 50
cow(530065) G protein-coupled receptor 50
Horse(100069508) G protein-coupled receptor 50
sheep(443023) G protein-coupled receptor 50
naked mole-rat(101706883) G protein-coupled receptor 50
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004224 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010340 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010340 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010340 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004224 Rosetta Predictions human pricing
XM_001067242 Rosetta Predictions rat pricing
XM_346374 Rosetta Predictions rat pricing
NM_010340 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050679 predicted 360
2 SASI_Hs02_00337138 predicted 373
3 SASI_Hs02_00337139 predicted 1222
4 SASI_Hs01_00050681 predicted 815
5 SASI_Hs02_00337140 predicted 1929
6 SASI_Hs02_00337141 predicted 1899
7 SASI_Hs01_00050672 predicted 251
8 SASI_Hs01_00050673 predicted 1157
9 SASI_Hs01_00050674 predicted 313
10 SASI_Hs01_00050675 predicted 436
11 SASI_Hs01_00050676 predicted 1000
12 SASI_Hs01_00050677 predicted 826
13 SASI_Hs01_00050678 predicted 291
14 SASI_Hs01_00050680 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320386 predicted 1029
2 SASI_Rn02_00320387 predicted 321
3 SASI_Rn02_00320388 predicted 591
4 SASI_Rn02_00320389 predicted 699
5 SASI_Rn02_00320390 predicted 378
6 SASI_Rn02_00320391 predicted 1952
7 SASI_Rn02_00320392 predicted 828
8 SASI_Rn02_00320393 predicted 476
9 SASI_Rn02_00320394 predicted 1564
10 SASI_Rn02_00320395 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399364 predicted 1458
2 SASI_Rn02_00399365 predicted 1317
3 SASI_Rn02_00399366 predicted 1943
4 SASI_Rn02_00399367 predicted 1870
5 SASI_Rn02_00399368 predicted 1472
6 SASI_Rn02_00399369 predicted 220
7 SASI_Rn02_00399370 predicted 1563
8 SASI_Rn02_00399371 predicted 1351
9 SASI_Rn02_00399372 predicted 1892
10 SASI_Rn02_00399373 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106926 predicted 936
2 SASI_Mm01_00106927 predicted 656
3 SASI_Mm01_00106928 predicted 730
4 SASI_Mm01_00106929 predicted 536
5 SASI_Mm02_00318345 predicted 1351
6 SASI_Mm01_00106930 predicted 728
7 SASI_Mm01_00106931 predicted 986
8 SASI_Mm01_00106932 predicted 1466
9 SASI_Mm01_00106934 predicted 607
10 SASI_Mm01_00106935 predicted 1244
11 SASI_Mm01_00106933 predicted 1296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004224
GPR50 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 50
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-1068s21c1
Sequence:CCGGTATGCGGCACCCTATCATATTCTCGAGAATATGATAGGGTGCCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-549s21c1
Sequence:CCGGGATCTTCAGTGTGCGCAATACCTCGAGGTATTGCGCACACTGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-339s21c1
Sequence:CCGGCAGTCTCTCTGTGGCCGATATCTCGAGATATCGGCCACAGAGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-198s21c1
Sequence:CCGGAGAATACCCACCGGCTCTAATCTCGAGATTAGAGCCGGTGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-1253s1c1
Sequence:CCGGCCTATCGCAAATCTGCCTCTACTCGAGTAGAGGCAGATTTGCGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-310s1c1
Sequence:CCGGCCATACCCTTTGATGCTGCATCTCGAGATGCAGCATCAAAGGGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-1153s1c1
Sequence:CCGGCCGATGAATGTCCGGAATGTTCTCGAGAACATTCCGGACATTCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-951s1c1
Sequence:CCGGCGGGCTCCTCAATGAGAATTTCTCGAGAAATTCTCATTGAGGAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-169s1c1
Sequence:CCGGGCGATGGTTATCACCATCGTTCTCGAGAACGATGGTGATAACCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004224
GPR50 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 50
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-1068s21c1
Sequence:CCGGTATGCGGCACCCTATCATATTCTCGAGAATATGATAGGGTGCCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-549s21c1
Sequence:CCGGGATCTTCAGTGTGCGCAATACCTCGAGGTATTGCGCACACTGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-339s21c1
Sequence:CCGGCAGTCTCTCTGTGGCCGATATCTCGAGATATCGGCCACAGAGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-198s21c1
Sequence:CCGGAGAATACCCACCGGCTCTAATCTCGAGATTAGAGCCGGTGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-1253s1c1
Sequence:CCGGCCTATCGCAAATCTGCCTCTACTCGAGTAGAGGCAGATTTGCGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-310s1c1
Sequence:CCGGCCATACCCTTTGATGCTGCATCTCGAGATGCAGCATCAAAGGGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-1153s1c1
Sequence:CCGGCCGATGAATGTCCGGAATGTTCTCGAGAACATTCCGGACATTCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-951s1c1
Sequence:CCGGCGGGCTCCTCAATGAGAATTTCTCGAGAAATTCTCATTGAGGAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-169s1c1
Sequence:CCGGGCGATGGTTATCACCATCGTTCTCGAGAACGATGGTGATAACCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004224
GPR50 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 50
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-1068s21c1
Sequence:CCGGTATGCGGCACCCTATCATATTCTCGAGAATATGATAGGGTGCCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-549s21c1
Sequence:CCGGGATCTTCAGTGTGCGCAATACCTCGAGGTATTGCGCACACTGAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-339s21c1
Sequence:CCGGCAGTCTCTCTGTGGCCGATATCTCGAGATATCGGCCACAGAGAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004224.2-198s21c1
Sequence:CCGGAGAATACCCACCGGCTCTAATCTCGAGATTAGAGCCGGTGGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-1253s1c1
Sequence:CCGGCCTATCGCAAATCTGCCTCTACTCGAGTAGAGGCAGATTTGCGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-310s1c1
Sequence:CCGGCCATACCCTTTGATGCTGCATCTCGAGATGCAGCATCAAAGGGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-1153s1c1
Sequence:CCGGCCGATGAATGTCCGGAATGTTCTCGAGAACATTCCGGACATTCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-951s1c1
Sequence:CCGGCGGGCTCCTCAATGAGAATTTCTCGAGAAATTCTCATTGAGGAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004224.1-169s1c1
Sequence:CCGGGCGATGGTTATCACCATCGTTCTCGAGAACGATGGTGATAACCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010340
GPR50 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 50
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000025780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010340.1-121s1c1
Sequence:CCGGGCCAGCTCTAATCATCTTCATCTCGAGATGAAGATGATTAGAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010340.1-223s1c1
Sequence:CCGGGCTCCGAAATTCTGGCAACATCTCGAGATGTTGCCAGAATTTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010340
GPR50 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 50
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000025780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010340.1-121s1c1
Sequence:CCGGGCCAGCTCTAATCATCTTCATCTCGAGATGAAGATGATTAGAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010340.1-223s1c1
Sequence:CCGGGCTCCGAAATTCTGGCAACATCTCGAGATGTTGCCAGAATTTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010340
GPR50 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 50
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000025780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010340.1-121s1c1
Sequence:CCGGGCCAGCTCTAATCATCTTCATCTCGAGATGAAGATGATTAGAGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010340.1-223s1c1
Sequence:CCGGGCTCCGAAATTCTGGCAACATCTCGAGATGTTGCCAGAATTTCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks