EMAIL THIS PAGE TO A FRIEND

GPR52

G protein-coupled receptor 52

84 Gene Product Result for
UniProtKB ID: Q9Y2T5, O75654, Q4VBL6, Q6ISM0
Gene ID:
Human(9293) Summary: Members of the G protein-coupled receptor (GPR) family play important roles in signal transduction from the external environment to the inside of the cell.[supplied by OMIM, Jul 2002]
Mouse(620246) G protein-coupled receptor 52
Rat(680192) G protein-coupled receptor 52
chicken(771016) G protein-coupled receptor 52
cow(506159) G protein-coupled receptor 52
Horse(100052614) G protein-coupled receptor 52
domestic cat(101095630) G protein-coupled receptor 52
dog(100683121) G protein-coupled receptor 52
naked mole-rat(101719622) G protein-coupled receptor 52
sheep(101115723) G protein-coupled receptor 52
Domestic Rabbit(100346029) G protein-coupled receptor 52
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005684 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_885170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_885170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_885170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141781 MISSION® esiRNA esiRNA human GPR52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005684 Rosetta Predictions human pricing
XM_001055077 Rosetta Predictions rat pricing
XM_885170 Rosetta Predictions mouse pricing
XM_917214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238375 predicted 1027
2 SASI_Hs01_00238376 predicted 947
3 SASI_Hs01_00238378 predicted 302
4 SASI_Hs01_00238379 predicted 241
5 SASI_Hs02_00340079 predicted 474
6 SASI_Hs01_00238380 predicted 382
7 SASI_Hs01_00238381 predicted 535
8 SASI_Hs01_00238382 predicted 361
9 SASI_Hs01_00238384 predicted 529
10 SASI_Hs02_00340080 predicted 206
11 SASI_Hs01_00238377 predicted 881
12 SASI_Hs01_00238383 predicted 411
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278365 predicted 1090
2 SASI_Rn02_00278366 predicted 1055
3 SASI_Rn02_00278367 predicted 833
4 SASI_Rn02_00278368 predicted 864
5 SASI_Rn02_00278369 predicted 204
6 SASI_Rn02_00278370 predicted 773
7 SASI_Rn02_00278371 predicted 738
8 SASI_Rn02_00278372 predicted 248
9 SASI_Rn02_00278373 predicted 989
10 SASI_Rn02_00278374 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428183 predicted 863
2 SASI_Mm01_00203487 predicted 451
3 SASI_Mm01_00203488 predicted 251
4 SASI_Mm01_00203490 predicted 204
5 SASI_Mm01_00203492 predicted 577
6 SASI_Mm01_00203493 predicted 293
7 SASI_Mm01_00203494 predicted 335
8 SASI_Mm01_00203495 predicted 272
9 SASI_Mm01_00203496 predicted 736
10 SASI_Mm02_00428184 predicted 352
11 SASI_Mm01_00203489 predicted 480
12 SASI_Mm01_00203491 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00440947 predicted 856
2 SASI_Mm02_00440948 predicted 451
3 SASI_Mm02_00440949 predicted 250
4 SASI_Mm02_00440950 predicted 204
5 SASI_Mm02_00440951 predicted 576
6 SASI_Mm02_00440952 predicted 291
7 SASI_Mm02_00440953 predicted 341
8 SASI_Mm02_00440954 predicted 271
9 SASI_Mm02_00440955 predicted 735
10 SASI_Mm02_00440956 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005684
GPR52 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 52
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-912s1c1
Sequence:CCGGGCTTGCAGTAAGTAATAGTTTCTCGAGAAACTATTACTTACTGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-701s1c1
Sequence:CCGGCCAAAGAGATAAATGACCGAACTCGAGTTCGGTCATTTATCTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-202s1c1
Sequence:CCGGGCTCCACTGTTACATCATTATCTCGAGATAATGATGTAACAGTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-610s1c1
Sequence:CCGGACTGGCTTTATTGTTTGCTTACTCGAGTAAGCAAACAATAAAGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-179s1c1
Sequence:CCGGCAGTTATCTTTGCCTTTCATTCTCGAGAATGAAAGGCAAAGATAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005684.4-1091s21c1
Sequence:CCGGACCTAGGAAACGGGCTAATTCCTCGAGGAATTAGCCCGTTTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005684.4-197s21c1
Sequence:CCGGGATCATTGCTGGGAATCTAACCTCGAGGTTAGATTCCCAGCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005684.4-239s21c1
Sequence:CCGGTGCTCCACTGTTACATCATTACTCGAGTAATGATGTAACAGTGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005684
GPR52 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 52
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-912s1c1
Sequence:CCGGGCTTGCAGTAAGTAATAGTTTCTCGAGAAACTATTACTTACTGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-701s1c1
Sequence:CCGGCCAAAGAGATAAATGACCGAACTCGAGTTCGGTCATTTATCTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-202s1c1
Sequence:CCGGGCTCCACTGTTACATCATTATCTCGAGATAATGATGTAACAGTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-610s1c1
Sequence:CCGGACTGGCTTTATTGTTTGCTTACTCGAGTAAGCAAACAATAAAGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-179s1c1
Sequence:CCGGCAGTTATCTTTGCCTTTCATTCTCGAGAATGAAAGGCAAAGATAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005684.4-1091s21c1
Sequence:CCGGACCTAGGAAACGGGCTAATTCCTCGAGGAATTAGCCCGTTTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005684.4-197s21c1
Sequence:CCGGGATCATTGCTGGGAATCTAACCTCGAGGTTAGATTCCCAGCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005684.4-239s21c1
Sequence:CCGGTGCTCCACTGTTACATCATTACTCGAGTAATGATGTAACAGTGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005684
GPR52 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 52
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-912s1c1
Sequence:CCGGGCTTGCAGTAAGTAATAGTTTCTCGAGAAACTATTACTTACTGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-701s1c1
Sequence:CCGGCCAAAGAGATAAATGACCGAACTCGAGTTCGGTCATTTATCTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-202s1c1
Sequence:CCGGGCTCCACTGTTACATCATTATCTCGAGATAATGATGTAACAGTGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-610s1c1
Sequence:CCGGACTGGCTTTATTGTTTGCTTACTCGAGTAAGCAAACAATAAAGCCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005684.1-179s1c1
Sequence:CCGGCAGTTATCTTTGCCTTTCATTCTCGAGAATGAAAGGCAAAGATAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005684.4-1091s21c1
Sequence:CCGGACCTAGGAAACGGGCTAATTCCTCGAGGAATTAGCCCGTTTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005684.4-197s21c1
Sequence:CCGGGATCATTGCTGGGAATCTAACCTCGAGGTTAGATTCCCAGCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005684.4-239s21c1
Sequence:CCGGTGCTCCACTGTTACATCATTACTCGAGTAATGATGTAACAGTGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_885170
GPR52 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 52
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-340s21c1
Sequence:CCGGTGCCAGGTGTTTGGATATATTCTCGAGAATATATCCAAACACCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-158s21c1
Sequence:GTACCGGTGATCATCTCTGGGAATTTAACTCGAGTTAAATTCCCAGAGATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-653s21c1
Sequence:GTACCGGTTGTCTGCTTCACTTACTTTCCTCGAGGAAAGTAAGTGAAGCAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-411s21c1
Sequence:GTACCGGGGATCGATATCTTGCAATAACCTCGAGGTTATTGCAAGATATCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-203s21c1
Sequence:CCGGCTCCGCTGTTACACCATTATACTCGAGTATAATGGTGTAACAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_885170
GPR52 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 52
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-340s21c1
Sequence:CCGGTGCCAGGTGTTTGGATATATTCTCGAGAATATATCCAAACACCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-158s21c1
Sequence:GTACCGGTGATCATCTCTGGGAATTTAACTCGAGTTAAATTCCCAGAGATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-653s21c1
Sequence:GTACCGGTTGTCTGCTTCACTTACTTTCCTCGAGGAAAGTAAGTGAAGCAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-411s21c1
Sequence:GTACCGGGGATCGATATCTTGCAATAACCTCGAGGTTATTGCAAGATATCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-203s21c1
Sequence:CCGGCTCCGCTGTTACACCATTATACTCGAGTATAATGGTGTAACAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_885170
GPR52 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 52
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-340s21c1
Sequence:CCGGTGCCAGGTGTTTGGATATATTCTCGAGAATATATCCAAACACCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-158s21c1
Sequence:GTACCGGTGATCATCTCTGGGAATTTAACTCGAGTTAAATTCCCAGAGATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-653s21c1
Sequence:GTACCGGTTGTCTGCTTCACTTACTTTCCTCGAGGAAAGTAAGTGAAGCAGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-411s21c1
Sequence:GTACCGGGGATCGATATCTTGCAATAACCTCGAGGTTATTGCAAGATATCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_885170.2-203s21c1
Sequence:CCGGCTCCGCTGTTACACCATTATACTCGAGTATAATGGTGTAACAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks