EMAIL THIS PAGE TO A FRIEND

GPR55

G protein-coupled receptor 55

62 Gene Product Result for
UniProtKB ID: Q9Y2T6, Q8N580
Gene ID:
Human(9290) Summary: Members of the G protein-coupled receptor (GPR) family, such as GPR55, play important roles in signal transduction from the external environment to the inside of the cell (Sawzdargo et al., 1999 [PubMed 9931487]
Mouse(227326) G protein-coupled receptor 55
Rat(501177) G protein-coupled receptor 55
chicken(770641) G protein-coupled receptor 55
dog(486157) G protein-coupled receptor 55
cow(539107) G protein-coupled receptor 55
domestic cat(101094199) G protein-coupled receptor 55
sheep(101121499) G protein-coupled receptor 55
domestic guinea pig(100726859) G protein-coupled receptor 55
naked mole-rat(101697975) G protein-coupled receptor 55
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005683 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044061 MISSION® esiRNA esiRNA human GPR55 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005683 Rosetta Predictions human pricing
XM_001063474 Rosetta Predictions rat pricing
XM_576605 Rosetta Predictions rat pricing
NM_001033290 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109315 predicted 1187
2 SASI_Hs02_00340078 predicted 1249
3 SASI_Hs01_00109316 predicted 539
4 SASI_Hs01_00109317 predicted 1229
5 SASI_Hs01_00109318 predicted 890
6 SASI_Hs01_00109319 predicted 700
7 SASI_Hs01_00109320 predicted 846
8 SASI_Hs01_00109321 predicted 1201
9 SASI_Hs01_00109322 predicted 653
10 SASI_Hs01_00109323 predicted 1006
11 SASI_Hs01_00109324 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307256 predicted 514
2 SASI_Rn02_00307257 predicted 411
3 SASI_Rn02_00307258 predicted 263
4 SASI_Rn02_00307259 predicted 313
5 SASI_Rn02_00307260 predicted 488
6 SASI_Rn02_00307261 predicted 363
7 SASI_Rn02_00307262 predicted 660
8 SASI_Rn02_00307263 predicted 569
9 SASI_Rn02_00307264 predicted 673
10 SASI_Rn02_00307265 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405613 predicted 514
2 SASI_Rn02_00405614 predicted 417
3 SASI_Rn02_00405615 predicted 264
4 SASI_Rn02_00405616 predicted 320
5 SASI_Rn02_00405617 predicted 485
6 SASI_Rn02_00405618 predicted 369
7 SASI_Rn02_00405619 predicted 658
8 SASI_Rn02_00405620 predicted 573
9 SASI_Rn02_00405621 predicted 671
10 SASI_Rn02_00405622 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288487 predicted 240
2 SASI_Mm01_00131393 predicted 1110
3 SASI_Mm01_00131394 predicted 383
4 SASI_Mm02_00288488 predicted 398
5 SASI_Mm01_00131395 predicted 1169
6 SASI_Mm02_00288489 predicted 885
7 SASI_Mm01_00131396 predicted 532
8 SASI_Mm01_00131397 predicted 252
9 SASI_Mm01_00131398 predicted 935
10 SASI_Mm02_00288490 predicted 257
11 SASI_Mm01_00131392 predicted 704
12 SASI_Mm01_00131399 predicted 675
13 SASI_Mm01_00131400 predicted 685
14 SASI_Mm01_00131401 predicted 199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005683
GPR55 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 55
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005683.3-342s21c1
Sequence:CCGGAGAACAGGTGGCCCGATTATGCTCGAGCATAATCGGGCCACCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005683.3-1288s21c1
Sequence:CCGGGTGCCAGCTTTGCTCATTATACTCGAGTATAATGAGCAAAGCTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005683.3-1382s21c1
Sequence:CCGGGACCAGGTGAATTACTGATTTCTCGAGAAATCAGTAATTCACCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005683.3-381s21c1
Sequence:CCGGTGATCAACCTGGCAGTCTTTGCTCGAGCAAAGACTGCCAGGTTGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005683.2-2040s1c1
Sequence:CCGGCCAGCGATGTTCAAACATAAACTCGAGTTTATGTTTGAACATCGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-487s1c1
Sequence:CCGGGTGCCTTTACTTCGTCAGCATCTCGAGATGCTGACGAAGTAAAGGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-1052s1c1
Sequence:CCGGTGCTACTACTTTGTCATCAAACTCGAGTTTGATGACAAAGTAGTAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-256s1c1
Sequence:CCGGCCTACAGTTTGCAGTCCACATCTCGAGATGTGGACTGCAAACTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-1012s1c1
Sequence:CCGGCATGTGTTTCTCCAACGTCAACTCGAGTTGACGTTGGAGAAACACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005683
GPR55 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 55
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005683.3-342s21c1
Sequence:CCGGAGAACAGGTGGCCCGATTATGCTCGAGCATAATCGGGCCACCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005683.3-1288s21c1
Sequence:CCGGGTGCCAGCTTTGCTCATTATACTCGAGTATAATGAGCAAAGCTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005683.3-1382s21c1
Sequence:CCGGGACCAGGTGAATTACTGATTTCTCGAGAAATCAGTAATTCACCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005683.3-381s21c1
Sequence:CCGGTGATCAACCTGGCAGTCTTTGCTCGAGCAAAGACTGCCAGGTTGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005683.2-2040s1c1
Sequence:CCGGCCAGCGATGTTCAAACATAAACTCGAGTTTATGTTTGAACATCGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-487s1c1
Sequence:CCGGGTGCCTTTACTTCGTCAGCATCTCGAGATGCTGACGAAGTAAAGGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-1052s1c1
Sequence:CCGGTGCTACTACTTTGTCATCAAACTCGAGTTTGATGACAAAGTAGTAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-256s1c1
Sequence:CCGGCCTACAGTTTGCAGTCCACATCTCGAGATGTGGACTGCAAACTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-1012s1c1
Sequence:CCGGCATGTGTTTCTCCAACGTCAACTCGAGTTGACGTTGGAGAAACACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005683
GPR55 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 55
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005683.3-342s21c1
Sequence:CCGGAGAACAGGTGGCCCGATTATGCTCGAGCATAATCGGGCCACCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005683.3-1288s21c1
Sequence:CCGGGTGCCAGCTTTGCTCATTATACTCGAGTATAATGAGCAAAGCTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005683.3-1382s21c1
Sequence:CCGGGACCAGGTGAATTACTGATTTCTCGAGAAATCAGTAATTCACCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005683.3-381s21c1
Sequence:CCGGTGATCAACCTGGCAGTCTTTGCTCGAGCAAAGACTGCCAGGTTGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005683.2-2040s1c1
Sequence:CCGGCCAGCGATGTTCAAACATAAACTCGAGTTTATGTTTGAACATCGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-487s1c1
Sequence:CCGGGTGCCTTTACTTCGTCAGCATCTCGAGATGCTGACGAAGTAAAGGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-1052s1c1
Sequence:CCGGTGCTACTACTTTGTCATCAAACTCGAGTTTGATGACAAAGTAGTAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-256s1c1
Sequence:CCGGCCTACAGTTTGCAGTCCACATCTCGAGATGTGGACTGCAAACTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005683.2-1012s1c1
Sequence:CCGGCATGTGTTTCTCCAACGTCAACTCGAGTTGACGTTGGAGAAACACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033290
GPR55 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 55
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-821s21c1
Sequence:CCGGTTCTGTTCCTATAGGAGTATTCTCGAGAATACTCCTATAGGAACAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-1003s21c1
Sequence:CCGGTCTGGTGAGGAACCGCTTTATCTCGAGATAAAGCGGTTCCTCACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-257s21c1
Sequence:CCGGTCATTCGATTCCGTGGATAAGCTCGAGCTTATCCACGGAATCGAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033290.2-1545s21c1
Sequence:CCGGGCGAAAGGGCAGGGAATTTAGCTCGAGCTAAATTCCCTGCCCTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-289s21c1
Sequence:CCGGCTTGCAGCTGGCAGTCCATATCTCGAGATATGGACTGCCAGCTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033290
GPR55 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 55
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-821s21c1
Sequence:CCGGTTCTGTTCCTATAGGAGTATTCTCGAGAATACTCCTATAGGAACAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-1003s21c1
Sequence:CCGGTCTGGTGAGGAACCGCTTTATCTCGAGATAAAGCGGTTCCTCACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-257s21c1
Sequence:CCGGTCATTCGATTCCGTGGATAAGCTCGAGCTTATCCACGGAATCGAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033290.2-1545s21c1
Sequence:CCGGGCGAAAGGGCAGGGAATTTAGCTCGAGCTAAATTCCCTGCCCTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-289s21c1
Sequence:CCGGCTTGCAGCTGGCAGTCCATATCTCGAGATATGGACTGCCAGCTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033290
GPR55 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 55
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-821s21c1
Sequence:CCGGTTCTGTTCCTATAGGAGTATTCTCGAGAATACTCCTATAGGAACAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-1003s21c1
Sequence:CCGGTCTGGTGAGGAACCGCTTTATCTCGAGATAAAGCGGTTCCTCACCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-257s21c1
Sequence:CCGGTCATTCGATTCCGTGGATAAGCTCGAGCTTATCCACGGAATCGAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033290.2-1545s21c1
Sequence:CCGGGCGAAAGGGCAGGGAATTTAGCTCGAGCTAAATTCCCTGCCCTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033290.2-289s21c1
Sequence:CCGGCTTGCAGCTGGCAGTCCATATCTCGAGATATGGACTGCCAGCTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)