EMAIL THIS PAGE TO A FRIEND

GPR56

G protein-coupled receptor 56

128 Gene Product Result for
Synonyms: BFPP TM7LN4 TM7XN1
Gene ID:
Human(9289) Summary: This gene encodes a member of the G protein-coupled receptor family. The protein contains 7 transmembrane domains and a mucin-like domain in the N-terminal region. The gene is implicated in the regulation of brain cortical patterning. The protein binds specifically to transglutaminase 2 in the extracellular space. Expression of this gene is downregulated in melanoma cell lines, and overexpression of this gene can suppress tumor growth and metastasis. Mutations in this gene result in bilateral frontoparietal polymicrogyria. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(14766) G protein-coupled receptor 56
Rat(260326) G protein-coupled receptor 56
Zebrafish(324948) G protein-coupled receptor 56
domestic cat(101086022) G protein-coupled receptor 56
dog(487261) G protein-coupled receptor 56
chicken(415633) G protein-coupled receptor 56
domestic guinea pig(100721995) G protein-coupled receptor 56
naked mole-rat(101724395) G protein-coupled receptor 56
sheep(101120942) G protein-coupled receptor 56
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1493 Human GPR56 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005682 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005682 Rosetta Predictions human pricing
NM_201524 Rosetta Predictions human pricing
NM_201525 Rosetta Predictions human pricing
NM_152242 Rosetta Predictions rat pricing
NM_018882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065685 predicted 531
2 SASI_Hs02_00340075 predicted 2148
3 SASI_Hs01_00065686 predicted 2353
4 SASI_Hs01_00065687 predicted 743
5 SASI_Hs02_00340076 predicted 1965
6 SASI_Hs01_00065689 predicted 1768
7 SASI_Hs01_00065690 predicted 1256
8 SASI_Hs01_00065693 predicted 936
9 SASI_Hs01_00065694 predicted 644
10 SASI_Hs02_00340077 predicted 2657
11 SASI_Hs01_00065688 predicted 534
12 SASI_Hs01_00065691 predicted 1239
13 SASI_Hs01_00065692 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242890 predicted 618
2 SASI_Hs02_00373001 predicted 2217
3 SASI_Hs01_00242891 predicted 2422
4 SASI_Hs01_00242892 predicted 829
5 SASI_Hs02_00373002 predicted 2033
6 SASI_Hs01_00242894 predicted 1837
7 SASI_Hs01_00242895 predicted 1343
8 SASI_Hs01_00242898 predicted 1016
9 SASI_Hs01_00242899 predicted 722
10 SASI_Hs02_00373003 predicted 2723
11 SASI_Hs01_00242893 predicted 617
12 SASI_Hs01_00242896 predicted 1322
13 SASI_Hs01_00242897 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021874 predicted 516
2 SASI_Hs02_00373004 predicted 2116
3 SASI_Hs01_00021875 predicted 2326
4 SASI_Hs01_00021876 predicted 733
5 SASI_Hs02_00373005 predicted 1928
6 SASI_Hs01_00021878 predicted 1729
7 SASI_Hs01_00021879 predicted 1241
8 SASI_Hs01_00021882 predicted 921
9 SASI_Hs01_00021883 predicted 621
10 SASI_Hs02_00373006 predicted 2620
11 SASI_Hs01_00021877 predicted 513
12 SASI_Hs01_00021880 predicted 1223
13 SASI_Hs01_00021881 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102257 predicted 1794
2 SASI_Rn02_00268900 predicted 540
3 SASI_Rn02_00268901 predicted 1402
4 SASI_Rn02_00268902 predicted 780
5 SASI_Rn02_00268903 predicted 424
6 SASI_Rn01_00102260 predicted 1759
7 SASI_Rn01_00102261 predicted 1582
8 SASI_Rn01_00102264 predicted 2440
9 SASI_Rn02_00268904 predicted 1209
10 SASI_Rn02_00268905 predicted 984
11 SASI_Rn01_00102258 predicted 418
12 SASI_Rn01_00102259 predicted 2182
13 SASI_Rn01_00102262 predicted 1304
14 SASI_Rn01_00102263 predicted 1474
15 SASI_Rn01_00102265 predicted 1182
16 SASI_Rn01_00102266 predicted 1970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176040 predicted 1573
2 SASI_Mm01_00176041 predicted 553
3 SASI_Mm01_00176042 predicted 665
4 SASI_Mm01_00176043 predicted 1534
5 SASI_Mm01_00176044 predicted 1361
6 SASI_Mm02_00324288 predicted 1241
7 SASI_Mm02_00324289 predicted 1002
8 SASI_Mm02_00324290 predicted 1966
9 SASI_Mm01_00176045 predicted 1999
10 SASI_Mm01_00176047 predicted 2209
11 SASI_Mm01_00176038 predicted 572
12 SASI_Mm01_00176039 predicted 222
13 SASI_Mm01_00176046 predicted 957
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018882
VALIDATED
GPR56 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 56
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-200s1c1
Sequence:CCGGCCCTCCACTATGATCAATCTTCTCGAGAAGATTGATCATAGTGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-383s1c1
Sequence:CCGGGCAAGCATGACTACCTGCTTACTCGAGTAAGCAGGTAGTCATGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-1017s1c1
Sequence:CCGGGCAGAACACCAAAGTCACCAACTCGAGTTGGTGACTTTGGTGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018882.2-729s1c1
Sequence:CCGGCCTGGGAGACACATTATCCTTCTCGAGAAGGATAATGTGTCTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-1974s1c1
Sequence:CCGGCTTCAGCATCATAACTTCCTTCTCGAGAAGGAAGTTATGATGCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-1017s21c1
Sequence:CCGGGCAGAACACCAAAGTCACCAACTCGAGTTGGTGACTTTGGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-2270s21c1
Sequence:CCGGGTTGCTCTGGTAGGTAGATACCTCGAGGTATCTACCTACCAGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-1649s21c1
Sequence:CCGGTGGCGTTGGTGGATGTGAATACTCGAGTATTCACATCCACCAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-200s21c1
Sequence:CCGGCCCTCCACTATGATCAATCTTCTCGAGAAGATTGATCATAGTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-383s21c1
Sequence:CCGGGCAAGCATGACTACCTGCTTACTCGAGTAAGCAGGTAGTCATGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018882
VALIDATED
GPR56 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 56
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-200s1c1
Sequence:CCGGCCCTCCACTATGATCAATCTTCTCGAGAAGATTGATCATAGTGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-383s1c1
Sequence:CCGGGCAAGCATGACTACCTGCTTACTCGAGTAAGCAGGTAGTCATGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-1017s1c1
Sequence:CCGGGCAGAACACCAAAGTCACCAACTCGAGTTGGTGACTTTGGTGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018882.2-729s1c1
Sequence:CCGGCCTGGGAGACACATTATCCTTCTCGAGAAGGATAATGTGTCTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-1974s1c1
Sequence:CCGGCTTCAGCATCATAACTTCCTTCTCGAGAAGGAAGTTATGATGCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-1017s21c1
Sequence:CCGGGCAGAACACCAAAGTCACCAACTCGAGTTGGTGACTTTGGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-2270s21c1
Sequence:CCGGGTTGCTCTGGTAGGTAGATACCTCGAGGTATCTACCTACCAGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-1649s21c1
Sequence:CCGGTGGCGTTGGTGGATGTGAATACTCGAGTATTCACATCCACCAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-200s21c1
Sequence:CCGGCCCTCCACTATGATCAATCTTCTCGAGAAGATTGATCATAGTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-383s21c1
Sequence:CCGGGCAAGCATGACTACCTGCTTACTCGAGTAAGCAGGTAGTCATGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018882
VALIDATED
GPR56 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 56
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-200s1c1
Sequence:CCGGCCCTCCACTATGATCAATCTTCTCGAGAAGATTGATCATAGTGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-383s1c1
Sequence:CCGGGCAAGCATGACTACCTGCTTACTCGAGTAAGCAGGTAGTCATGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-1017s1c1
Sequence:CCGGGCAGAACACCAAAGTCACCAACTCGAGTTGGTGACTTTGGTGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018882.2-729s1c1
Sequence:CCGGCCTGGGAGACACATTATCCTTCTCGAGAAGGATAATGTGTCTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018882.2-1974s1c1
Sequence:CCGGCTTCAGCATCATAACTTCCTTCTCGAGAAGGAAGTTATGATGCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-1017s21c1
Sequence:CCGGGCAGAACACCAAAGTCACCAACTCGAGTTGGTGACTTTGGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-2270s21c1
Sequence:CCGGGTTGCTCTGGTAGGTAGATACCTCGAGGTATCTACCTACCAGAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-1649s21c1
Sequence:CCGGTGGCGTTGGTGGATGTGAATACTCGAGTATTCACATCCACCAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-200s21c1
Sequence:CCGGCCCTCCACTATGATCAATCTTCTCGAGAAGATTGATCATAGTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018882.2-383s21c1
Sequence:CCGGGCAAGCATGACTACCTGCTTACTCGAGTAAGCAGGTAGTCATGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005682
VALIDATED
GPR56 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 56
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-569s1c1
Sequence:CCGGGACTTCTTGCTGAGTGACAAACTCGAGTTTGTCACTCAGCAAGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005682.4-1981s1c1
Sequence:CCGGCCTGGTGTTTCTGTTCAACATCTCGAGATGTTGAACAGAAACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-1363s1c1
Sequence:CCGGCCAAACATCCTGCTTCTGCAACTCGAGTTGCAGAAGCAGGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-1875s1c1
Sequence:CCGGCCATCATCTTGGCTGTGCATACTCGAGTATGCACAGCCAAGATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-3608s1c1
Sequence:CCGGGCGTTCAATCTTGACCTTGAACTCGAGTTCAAGGTCAAGATTGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005682.5-617s21c1
Sequence:CCGGGACTTCTTGCTGAGTGACAAACTCGAGTTTGTCACTCAGCAAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005682.5-1923s21c1
Sequence:CCGGCCATCATCTTGGCTGTGCATACTCGAGTATGCACAGCCAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005682.5-2029s21c1
Sequence:CCGGCCTGGTGTTTCTGTTCAACATCTCGAGATGTTGAACAGAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005682.5-3656s21c1
Sequence:CCGGGCGTTCAATCTTGACCTTGAACTCGAGTTCAAGGTCAAGATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005682
VALIDATED
GPR56 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 56
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-569s1c1
Sequence:CCGGGACTTCTTGCTGAGTGACAAACTCGAGTTTGTCACTCAGCAAGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005682.4-1981s1c1
Sequence:CCGGCCTGGTGTTTCTGTTCAACATCTCGAGATGTTGAACAGAAACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-1363s1c1
Sequence:CCGGCCAAACATCCTGCTTCTGCAACTCGAGTTGCAGAAGCAGGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-1875s1c1
Sequence:CCGGCCATCATCTTGGCTGTGCATACTCGAGTATGCACAGCCAAGATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-3608s1c1
Sequence:CCGGGCGTTCAATCTTGACCTTGAACTCGAGTTCAAGGTCAAGATTGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005682.5-617s21c1
Sequence:CCGGGACTTCTTGCTGAGTGACAAACTCGAGTTTGTCACTCAGCAAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005682.5-1923s21c1
Sequence:CCGGCCATCATCTTGGCTGTGCATACTCGAGTATGCACAGCCAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005682.5-2029s21c1
Sequence:CCGGCCTGGTGTTTCTGTTCAACATCTCGAGATGTTGAACAGAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005682.5-3656s21c1
Sequence:CCGGGCGTTCAATCTTGACCTTGAACTCGAGTTCAAGGTCAAGATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005682
VALIDATED
GPR56 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 56
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-569s1c1
Sequence:CCGGGACTTCTTGCTGAGTGACAAACTCGAGTTTGTCACTCAGCAAGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005682.4-1981s1c1
Sequence:CCGGCCTGGTGTTTCTGTTCAACATCTCGAGATGTTGAACAGAAACACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-1363s1c1
Sequence:CCGGCCAAACATCCTGCTTCTGCAACTCGAGTTGCAGAAGCAGGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-1875s1c1
Sequence:CCGGCCATCATCTTGGCTGTGCATACTCGAGTATGCACAGCCAAGATGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005682.4-3608s1c1
Sequence:CCGGGCGTTCAATCTTGACCTTGAACTCGAGTTCAAGGTCAAGATTGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005682.5-617s21c1
Sequence:CCGGGACTTCTTGCTGAGTGACAAACTCGAGTTTGTCACTCAGCAAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005682.5-1923s21c1
Sequence:CCGGCCATCATCTTGGCTGTGCATACTCGAGTATGCACAGCCAAGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005682.5-2029s21c1
Sequence:CCGGCCTGGTGTTTCTGTTCAACATCTCGAGATGTTGAACAGAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005682.5-3656s21c1
Sequence:CCGGGCGTTCAATCTTGACCTTGAACTCGAGTTCAAGGTCAAGATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks