EMAIL THIS PAGE TO A FRIEND

GPR61

G protein-coupled receptor 61

Synonyms: BALGR GPCR3
UniProtKB ID: Q9BZJ8, A8K1W2, Q6NWS0, Q8TDV4, Q96PR4
Gene ID:
Human(83873) Summary: This gene belongs to the G-protein coupled receptor 1 family. G protein-coupled receptors contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. The protein encoded by this gene is most closely related to biogenic amine receptors. [provided by RefSeq, Jul 2008]
Mouse(229714) G protein-coupled receptor 61
Rat(310780) G protein-coupled receptor 61
domestic guinea pig(101787749) G protein-coupled receptor 61
naked mole-rat(101702334) G protein-coupled receptor 61
sheep(101106639) G protein-coupled receptor 61
Domestic Rabbit(100337741) G protein-coupled receptor 61
chicken(100858985) G protein-coupled receptor 61
domestic cat(101100070) G protein-coupled receptor 61
cow(540581) G protein-coupled receptor 61
Horse(100061655) G protein-coupled receptor 61
dog(479914) G protein-coupled receptor 61
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031936 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001911 MISSION® esiRNA esiRNA targeting human GPR61 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031936 Rosetta Predictions human pricing
NM_001107715 Rosetta Predictions rat pricing
NM_175470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245072 predicted 2163
2 SASI_Hs01_00245073 predicted 2461
3 SASI_Hs01_00245074 predicted 2030
4 SASI_Hs01_00245075 predicted 2451
5 SASI_Hs02_00359076 predicted 1974
6 SASI_Hs01_00245076 predicted 1078
7 SASI_Hs01_00245077 predicted 989
8 SASI_Hs01_00245078 predicted 1100
9 SASI_Hs01_00245080 predicted 1814
10 SASI_Hs01_00245081 predicted 798
11 SASI_Hs01_00245079 predicted 2013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231555 predicted 394
2 SASI_Rn02_00231556 predicted 413
3 SASI_Rn02_00231557 predicted 379
4 SASI_Rn02_00231558 predicted 322
5 SASI_Rn02_00231559 predicted 277
6 SASI_Rn02_00231560 predicted 387
7 SASI_Rn02_00231561 predicted 418
8 SASI_Rn02_00231562 predicted 409
9 SASI_Rn02_00231563 predicted 277
10 SASI_Rn02_00231564 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027392 predicted 1631
2 SASI_Mm01_00027383 predicted 1436
3 SASI_Mm01_00027384 predicted 1871
4 SASI_Mm01_00027387 predicted 1063
5 SASI_Mm01_00027389 predicted 1540
6 SASI_Mm01_00027390 predicted 1718
7 SASI_Mm01_00027391 predicted 1901
8 SASI_Mm01_00027385 predicted 2021
9 SASI_Mm02_00346383 predicted 969
10 SASI_Mm01_00027386 predicted 1567
11 SASI_Mm01_00027388 predicted 1089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175470
GPR61 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 61
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-846s1c1
Sequence:CCGGGCTGCTGTGATGGCTGTTATTCTCGAGAATAACAGCCATCACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1688s1c1
Sequence:CCGGCGGATGTCTCAACCGTCAGATCTCGAGATCTGACGGTTGAGACATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1556s1c1
Sequence:CCGGGCTTTGTTGGTTGCCCTACTTCTCGAGAAGTAGGGCAACCAACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1880s1c1
Sequence:CCGGCCCTGTTGTTGACTTTCGAATCTCGAGATTCGAAAGTCAACAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1249s1c1
Sequence:CCGGGTTCTCTCCAATGGAGCCATACTCGAGTATGGCTCCATTGGAGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175470
GPR61 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 61
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-846s1c1
Sequence:CCGGGCTGCTGTGATGGCTGTTATTCTCGAGAATAACAGCCATCACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1688s1c1
Sequence:CCGGCGGATGTCTCAACCGTCAGATCTCGAGATCTGACGGTTGAGACATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1556s1c1
Sequence:CCGGGCTTTGTTGGTTGCCCTACTTCTCGAGAAGTAGGGCAACCAACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1880s1c1
Sequence:CCGGCCCTGTTGTTGACTTTCGAATCTCGAGATTCGAAAGTCAACAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1249s1c1
Sequence:CCGGGTTCTCTCCAATGGAGCCATACTCGAGTATGGCTCCATTGGAGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175470
GPR61 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 61
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-846s1c1
Sequence:CCGGGCTGCTGTGATGGCTGTTATTCTCGAGAATAACAGCCATCACAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1688s1c1
Sequence:CCGGCGGATGTCTCAACCGTCAGATCTCGAGATCTGACGGTTGAGACATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1556s1c1
Sequence:CCGGGCTTTGTTGGTTGCCCTACTTCTCGAGAAGTAGGGCAACCAACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1880s1c1
Sequence:CCGGCCCTGTTGTTGACTTTCGAATCTCGAGATTCGAAAGTCAACAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175470.2-1249s1c1
Sequence:CCGGGTTCTCTCCAATGGAGCCATACTCGAGTATGGCTCCATTGGAGAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031936
GPR61 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 61
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031936.2-2041s1c1
Sequence:CCGGCCATGATCCATTAAATGCCTTCTCGAGAAGGCATTTAATGGATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-945s1c1
Sequence:CCGGTGGTGGTCTTTGCTGTCCTTTCTCGAGAAAGGACAGCAAAGACCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-1540s1c1
Sequence:CCGGACCTGCTGTTGACTTCCGAATCTCGAGATTCGGAAGTCAACAGCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-982s1c1
Sequence:CCGGGCTCCTCATACTTGTGGTCTACTCGAGTAGACCACAAGTATGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-1326s1c1
Sequence:CCGGCCAACCCTTTCTTCTATGGATCTCGAGATCCATAGAAGAAAGGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031936.4-2359s21c1
Sequence:CCGGATCGGGTACAAGAGACTTAAGCTCGAGCTTAAGTCTCTTGTACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031936.4-2399s21c1
Sequence:CCGGGGGTTTCCATGATCCATTAAACTCGAGTTTAATGGATCATGGAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031936.4-1918s21c1
Sequence:CCGGTTCGAATCCCAGGCCAGATAGCTCGAGCTATCTGGCCTGGGATTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031936.4-1090s21c1
Sequence:CCGGTCAATGTGGAGCGCTACTATTCTCGAGAATAGTAGCGCTCCACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031936
GPR61 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 61
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031936.2-2041s1c1
Sequence:CCGGCCATGATCCATTAAATGCCTTCTCGAGAAGGCATTTAATGGATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-945s1c1
Sequence:CCGGTGGTGGTCTTTGCTGTCCTTTCTCGAGAAAGGACAGCAAAGACCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-1540s1c1
Sequence:CCGGACCTGCTGTTGACTTCCGAATCTCGAGATTCGGAAGTCAACAGCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-982s1c1
Sequence:CCGGGCTCCTCATACTTGTGGTCTACTCGAGTAGACCACAAGTATGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-1326s1c1
Sequence:CCGGCCAACCCTTTCTTCTATGGATCTCGAGATCCATAGAAGAAAGGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031936.4-2359s21c1
Sequence:CCGGATCGGGTACAAGAGACTTAAGCTCGAGCTTAAGTCTCTTGTACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031936.4-2399s21c1
Sequence:CCGGGGGTTTCCATGATCCATTAAACTCGAGTTTAATGGATCATGGAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031936.4-1918s21c1
Sequence:CCGGTTCGAATCCCAGGCCAGATAGCTCGAGCTATCTGGCCTGGGATTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031936.4-1090s21c1
Sequence:CCGGTCAATGTGGAGCGCTACTATTCTCGAGAATAGTAGCGCTCCACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031936
GPR61 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 61
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031936.2-2041s1c1
Sequence:CCGGCCATGATCCATTAAATGCCTTCTCGAGAAGGCATTTAATGGATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-945s1c1
Sequence:CCGGTGGTGGTCTTTGCTGTCCTTTCTCGAGAAAGGACAGCAAAGACCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-1540s1c1
Sequence:CCGGACCTGCTGTTGACTTCCGAATCTCGAGATTCGGAAGTCAACAGCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-982s1c1
Sequence:CCGGGCTCCTCATACTTGTGGTCTACTCGAGTAGACCACAAGTATGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031936.2-1326s1c1
Sequence:CCGGCCAACCCTTTCTTCTATGGATCTCGAGATCCATAGAAGAAAGGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031936.4-2359s21c1
Sequence:CCGGATCGGGTACAAGAGACTTAAGCTCGAGCTTAAGTCTCTTGTACCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031936.4-2399s21c1
Sequence:CCGGGGGTTTCCATGATCCATTAAACTCGAGTTTAATGGATCATGGAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031936.4-1918s21c1
Sequence:CCGGTTCGAATCCCAGGCCAGATAGCTCGAGCTATCTGGCCTGGGATTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031936.4-1090s21c1
Sequence:CCGGTCAATGTGGAGCGCTACTATTCTCGAGAATAGTAGCGCTCCACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks