EMAIL THIS PAGE TO A FRIEND

GPR62

G protein-coupled receptor 62

92 Gene Product Result for
Synonyms: GPCR8 KPG_005
UniProtKB ID: Q9BZJ7, F1DAM4, Q5KU27
Gene ID:
Mouse(436090) G protein-coupled receptor 62
Rat(501049) G protein-coupled receptor 62
dog(608263) G protein-coupled receptor 62
cow(615280) G protein-coupled receptor 62
domestic cat(101091928) G protein-coupled receptor 62
sheep(101113106) G protein-coupled receptor 62
domestic guinea pig(100713769) G protein-coupled receptor 62
naked mole-rat(101726543) G protein-coupled receptor 62
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080865 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_975079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_975079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_975079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080865 Rosetta Predictions human pricing
XM_001073569 Rosetta Predictions rat pricing
XM_576464 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362648 predicted 675
2 SASI_Hs02_00362649 predicted 655
3 SASI_Hs02_00362650 predicted 1305
4 SASI_Hs02_00362651 predicted 1940
5 SASI_Hs02_00362652 predicted 993
6 SASI_Hs02_00362653 predicted 975
7 SASI_Hs02_00362654 predicted 1312
8 SASI_Hs02_00362655 predicted 672
9 SASI_Hs02_00362656 predicted 990
10 SASI_Hs02_00362657 predicted 1934
11 SASI_Hs01_00117648 predicted 1177
12 SASI_Hs01_00117649 predicted 996
13 SASI_Hs01_00117650 predicted 840
14 SASI_Hs01_00117651 predicted 999
15 SASI_Hs01_00117652 predicted 1245
16 SASI_Hs01_00117653 predicted 1876
17 SASI_Hs01_00117654 predicted 845
18 SASI_Hs01_00117655 predicted 1071
19 SASI_Hs01_00117656 predicted 1822
20 SASI_Hs01_00117657 predicted 1817
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343206 predicted 349
2 SASI_Rn02_00343207 predicted 721
3 SASI_Rn02_00343208 predicted 1346
4 SASI_Rn02_00343209 predicted 550
5 SASI_Rn02_00343210 predicted 1241
6 SASI_Rn02_00343211 predicted 1276
7 SASI_Rn02_00343212 predicted 1173
8 SASI_Rn02_00343213 predicted 1223
9 SASI_Rn02_00343214 predicted 302
10 SASI_Rn02_00343215 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405413 predicted 343
2 SASI_Rn02_00405414 predicted 717
3 SASI_Rn02_00405415 predicted 1348
4 SASI_Rn02_00405416 predicted 541
5 SASI_Rn02_00405417 predicted 1233
6 SASI_Rn02_00405418 predicted 1281
7 SASI_Rn02_00405419 predicted 1169
8 SASI_Rn02_00405420 predicted 1219
9 SASI_Rn02_00405421 predicted 299
10 SASI_Rn02_00405422 predicted 1367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080865
GPR62 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 62
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080865.3-999s21c1
Sequence:CCGGGGATAGCCGCCTTTCCATCTTCTCGAGAAGATGGAAAGGCGGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080865.3-1946s21c1
Sequence:CCGGACTGGACCAGTTTGGTATTAGCTCGAGCTAATACCAAACTGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080865.3-1316s21c1
Sequence:CCGGTCTTGCAATGCCTCCAGAGACCTCGAGGTCTCTGGAGGCATTGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080865.3-1882s21c1
Sequence:CCGGCCAAGGAGAGTCTGGACAAAGCTCGAGCTTTGTCCAGACTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080865.2-1631s1c1
Sequence:CCGGCCAGCATAGGTGGTTTGTGAACTCGAGTTCACAAACCACCTATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-925s1c1
Sequence:CCGGACTCTCTGGATAGCCGCCTTTCTCGAGAAAGGCGGCTATCCAGAGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-1078s1c1
Sequence:CCGGCGGAAGCCGAAGCGGCTGTCACTCGAGTGACAGCCGCTTCGGCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-299s1c1
Sequence:CCGGCTCAGAAGTCGCAGGCTCGTTCTCGAGAACGAGCCTGCGACTTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-602s1c1
Sequence:CCGGCCTGGCACGCTACCGCCTCATCTCGAGATGAGGCGGTAGCGTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080865
GPR62 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 62
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080865.3-999s21c1
Sequence:CCGGGGATAGCCGCCTTTCCATCTTCTCGAGAAGATGGAAAGGCGGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080865.3-1946s21c1
Sequence:CCGGACTGGACCAGTTTGGTATTAGCTCGAGCTAATACCAAACTGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080865.3-1316s21c1
Sequence:CCGGTCTTGCAATGCCTCCAGAGACCTCGAGGTCTCTGGAGGCATTGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080865.3-1882s21c1
Sequence:CCGGCCAAGGAGAGTCTGGACAAAGCTCGAGCTTTGTCCAGACTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080865.2-1631s1c1
Sequence:CCGGCCAGCATAGGTGGTTTGTGAACTCGAGTTCACAAACCACCTATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-925s1c1
Sequence:CCGGACTCTCTGGATAGCCGCCTTTCTCGAGAAAGGCGGCTATCCAGAGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-1078s1c1
Sequence:CCGGCGGAAGCCGAAGCGGCTGTCACTCGAGTGACAGCCGCTTCGGCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-299s1c1
Sequence:CCGGCTCAGAAGTCGCAGGCTCGTTCTCGAGAACGAGCCTGCGACTTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-602s1c1
Sequence:CCGGCCTGGCACGCTACCGCCTCATCTCGAGATGAGGCGGTAGCGTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080865
GPR62 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 62
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080865.3-999s21c1
Sequence:CCGGGGATAGCCGCCTTTCCATCTTCTCGAGAAGATGGAAAGGCGGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080865.3-1946s21c1
Sequence:CCGGACTGGACCAGTTTGGTATTAGCTCGAGCTAATACCAAACTGGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080865.3-1316s21c1
Sequence:CCGGTCTTGCAATGCCTCCAGAGACCTCGAGGTCTCTGGAGGCATTGCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080865.3-1882s21c1
Sequence:CCGGCCAAGGAGAGTCTGGACAAAGCTCGAGCTTTGTCCAGACTCTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011630    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080865.2-1631s1c1
Sequence:CCGGCCAGCATAGGTGGTTTGTGAACTCGAGTTCACAAACCACCTATGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-925s1c1
Sequence:CCGGACTCTCTGGATAGCCGCCTTTCTCGAGAAAGGCGGCTATCCAGAGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-1078s1c1
Sequence:CCGGCGGAAGCCGAAGCGGCTGTCACTCGAGTGACAGCCGCTTCGGCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-299s1c1
Sequence:CCGGCTCAGAAGTCGCAGGCTCGTTCTCGAGAACGAGCCTGCGACTTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080865.2-602s1c1
Sequence:CCGGCCTGGCACGCTACCGCCTCATCTCGAGATGAGGCGGTAGCGTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_975079
GPR62 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 62
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_975079.1-1329s21c1
Sequence:CCGGCTGTACTCAGTCCTATCTTTCCTCGAGGAAAGATAGGACTGAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-1195s21c1
Sequence:CCGGAGAGGCCACCTGAGACATTTCCTCGAGGAAATGTCTCAGGTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-777s21c1
Sequence:CCGGTAGACAGTCGCCTCTCCTTCTCTCGAGAGAAGGAGAGGCGACTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-345s21c1
Sequence:CCGGTTCAAGATGCCTTCTACTTAGCTCGAGCTAAGTAGAAGGCATCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-265s21c1
Sequence:CCGGTATCCTGGCGGTTCTCGTAGACTCGAGTCTACGAGAACCGCCAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_975079
GPR62 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 62
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_975079.1-1329s21c1
Sequence:CCGGCTGTACTCAGTCCTATCTTTCCTCGAGGAAAGATAGGACTGAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-1195s21c1
Sequence:CCGGAGAGGCCACCTGAGACATTTCCTCGAGGAAATGTCTCAGGTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-777s21c1
Sequence:CCGGTAGACAGTCGCCTCTCCTTCTCTCGAGAGAAGGAGAGGCGACTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-345s21c1
Sequence:CCGGTTCAAGATGCCTTCTACTTAGCTCGAGCTAAGTAGAAGGCATCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-265s21c1
Sequence:CCGGTATCCTGGCGGTTCTCGTAGACTCGAGTCTACGAGAACCGCCAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_975079
GPR62 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 62
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_975079.1-1329s21c1
Sequence:CCGGCTGTACTCAGTCCTATCTTTCCTCGAGGAAAGATAGGACTGAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-1195s21c1
Sequence:CCGGAGAGGCCACCTGAGACATTTCCTCGAGGAAATGTCTCAGGTGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-777s21c1
Sequence:CCGGTAGACAGTCGCCTCTCCTTCTCTCGAGAGAAGGAGAGGCGACTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-345s21c1
Sequence:CCGGTTCAAGATGCCTTCTACTTAGCTCGAGCTAAGTAGAAGGCATCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_975079.1-265s21c1
Sequence:CCGGTATCCTGGCGGTTCTCGTAGACTCGAGTCTACGAGAACCGCCAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks