EMAIL THIS PAGE TO A FRIEND

GPR63

G protein-coupled receptor 63

61 Gene Product Result for
Synonyms: PSP24(beta) PSP24B
UniProtKB ID: Q9BZJ6, Q9UJH3
Gene ID:
Human(81491) Summary: This gene encodes a G protein-coupled receptor. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
Mouse(81006) G protein-coupled receptor 63
Rat(297952) G protein-coupled receptor 63
domestic guinea pig(100720052) G protein-coupled receptor 63
naked mole-rat(101720855) G protein-coupled receptor 63
sheep(101105759) G protein-coupled receptor 63
Domestic Rabbit(100346631) G protein-coupled receptor 63
Zebrafish(100331471) G protein-coupled receptor 63
chicken(100857561) G protein-coupled receptor 63
cow(517696) G protein-coupled receptor 63
Horse(100071441) G protein-coupled receptor 63
domestic cat(101081139) G protein-coupled receptor 63
dog(100685057) G protein-coupled receptor 63
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030784 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030784 Rosetta Predictions human pricing
NM_001106640 Rosetta Predictions rat pricing
NM_030733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188950 predicted 440
2 SASI_Hs01_00188951 predicted 680
3 SASI_Hs01_00188952 predicted 981
4 SASI_Hs02_00358329 predicted 215
5 SASI_Hs01_00188953 predicted 1064
6 SASI_Hs01_00188954 predicted 453
7 SASI_Hs01_00188955 predicted 583
8 SASI_Hs01_00188957 predicted 765
9 SASI_Hs01_00188958 predicted 774
10 SASI_Hs02_00358330 predicted 1096
11 SASI_Hs01_00188956 predicted 511
12 SASI_Hs01_00188959 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220938 predicted 1012
2 SASI_Rn02_00220939 predicted 1201
3 SASI_Rn02_00220940 predicted 1296
4 SASI_Rn02_00220941 predicted 670
5 SASI_Rn02_00220942 predicted 854
6 SASI_Rn02_00220943 predicted 729
7 SASI_Rn02_00220944 predicted 1143
8 SASI_Rn02_00220945 predicted 1235
9 SASI_Rn02_00220946 predicted 1000
10 SASI_Rn02_00220947 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022160 predicted 667
2 SASI_Mm01_00022161 predicted 1240
3 SASI_Mm01_00022162 predicted 853
4 SASI_Mm01_00022163 predicted 1239
5 SASI_Mm01_00022164 predicted 1290
6 SASI_Mm01_00022165 predicted 1357
7 SASI_Mm01_00022166 predicted 477
8 SASI_Mm02_00336923 predicted 800
9 SASI_Mm01_00022167 predicted 999
10 SASI_Mm01_00022168 predicted 1220
11 SASI_Mm01_00022169 predicted 1119
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030733
GPR63 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 63
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-867s1c1
Sequence:CCGGCCAGATGGATATTTGGGAAATCTCGAGATTTCCCAAATATCCATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-483s1c1
Sequence:CCGGCGACGTTTGTAGTCTTTGAAACTCGAGTTTCAAAGACTACAAACGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-528s1c1
Sequence:CCGGCGCTACCATTTCAGCATCCTACTCGAGTAGGATGCTGAAATGGTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-1538s1c1
Sequence:CCGGCTGATATACTACTGGAGGATTCTCGAGAATCCTCCAGTAGTATATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-1591s1c1
Sequence:CCGGGCCCAAGTCTTTCAAGTTCTTCTCGAGAAGAACTTGAAAGACTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030733
GPR63 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 63
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-867s1c1
Sequence:CCGGCCAGATGGATATTTGGGAAATCTCGAGATTTCCCAAATATCCATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-483s1c1
Sequence:CCGGCGACGTTTGTAGTCTTTGAAACTCGAGTTTCAAAGACTACAAACGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-528s1c1
Sequence:CCGGCGCTACCATTTCAGCATCCTACTCGAGTAGGATGCTGAAATGGTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-1538s1c1
Sequence:CCGGCTGATATACTACTGGAGGATTCTCGAGAATCCTCCAGTAGTATATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-1591s1c1
Sequence:CCGGGCCCAAGTCTTTCAAGTTCTTCTCGAGAAGAACTTGAAAGACTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030733
GPR63 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 63
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-867s1c1
Sequence:CCGGCCAGATGGATATTTGGGAAATCTCGAGATTTCCCAAATATCCATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-483s1c1
Sequence:CCGGCGACGTTTGTAGTCTTTGAAACTCGAGTTTCAAAGACTACAAACGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-528s1c1
Sequence:CCGGCGCTACCATTTCAGCATCCTACTCGAGTAGGATGCTGAAATGGTAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-1538s1c1
Sequence:CCGGCTGATATACTACTGGAGGATTCTCGAGAATCCTCCAGTAGTATATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030733.2-1591s1c1
Sequence:CCGGGCCCAAGTCTTTCAAGTTCTTCTCGAGAAGAACTTGAAAGACTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030784
GPR63 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 63
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030784.1-1659s1c1
Sequence:CCGGCCTCCAGGGTTCAATAGAAATCTCGAGATTTCTATTGAACCCTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-243s1c1
Sequence:CCGGCGGGACATCCAACACAACATTCTCGAGAATGTTGTGTTGGATGTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-1311s1c1
Sequence:CCGGGCTGATCTACTACTGGAGGATCTCGAGATCCTCCAGTAGTAGATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-972s1c1
Sequence:CCGGCCTGGTAATACTGTACTCATTCTCGAGAATGAGTACAGTATTACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-620s1c1
Sequence:CCGGCCCTGGTAACTATTCTTACTACTCGAGTAGTAAGAATAGTTACCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030784.2-1190s21c1
Sequence:CCGGATAGCTACCCTGAAGGTATATCTCGAGATATACCTTCAGGGTAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030784.2-604s21c1
Sequence:CCGGATCACCCTTTCTGCTATAATGCTCGAGCATTATAGCAGAAAGGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030784.2-1289s21c1
Sequence:CCGGCACGTGCCTTCACCACTATTTCTCGAGAAATAGTGGTGAAGGCACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030784
GPR63 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 63
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030784.1-1659s1c1
Sequence:CCGGCCTCCAGGGTTCAATAGAAATCTCGAGATTTCTATTGAACCCTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-243s1c1
Sequence:CCGGCGGGACATCCAACACAACATTCTCGAGAATGTTGTGTTGGATGTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-1311s1c1
Sequence:CCGGGCTGATCTACTACTGGAGGATCTCGAGATCCTCCAGTAGTAGATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-972s1c1
Sequence:CCGGCCTGGTAATACTGTACTCATTCTCGAGAATGAGTACAGTATTACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-620s1c1
Sequence:CCGGCCCTGGTAACTATTCTTACTACTCGAGTAGTAAGAATAGTTACCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030784.2-1190s21c1
Sequence:CCGGATAGCTACCCTGAAGGTATATCTCGAGATATACCTTCAGGGTAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030784.2-604s21c1
Sequence:CCGGATCACCCTTTCTGCTATAATGCTCGAGCATTATAGCAGAAAGGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030784.2-1289s21c1
Sequence:CCGGCACGTGCCTTCACCACTATTTCTCGAGAAATAGTGGTGAAGGCACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030784
GPR63 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 63
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030784.1-1659s1c1
Sequence:CCGGCCTCCAGGGTTCAATAGAAATCTCGAGATTTCTATTGAACCCTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-243s1c1
Sequence:CCGGCGGGACATCCAACACAACATTCTCGAGAATGTTGTGTTGGATGTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-1311s1c1
Sequence:CCGGGCTGATCTACTACTGGAGGATCTCGAGATCCTCCAGTAGTAGATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-972s1c1
Sequence:CCGGCCTGGTAATACTGTACTCATTCTCGAGAATGAGTACAGTATTACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030784.1-620s1c1
Sequence:CCGGCCCTGGTAACTATTCTTACTACTCGAGTAGTAAGAATAGTTACCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030784.2-1190s21c1
Sequence:CCGGATAGCTACCCTGAAGGTATATCTCGAGATATACCTTCAGGGTAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030784.2-604s21c1
Sequence:CCGGATCACCCTTTCTGCTATAATGCTCGAGCATTATAGCAGAAAGGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030784.2-1289s21c1
Sequence:CCGGCACGTGCCTTCACCACTATTTCTCGAGAAATAGTGGTGAAGGCACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)