EMAIL THIS PAGE TO A FRIEND

GPR64

G protein-coupled receptor 64

221 Gene Product Result for
Synonyms: EDDM6 HE6 TM7LN2
Gene ID:
Human(10149) Summary: This gene encodes a member of the G protein-coupled receptor family described as an epididymis-specific transmembrane protein. The encoded protein may be proteolytically processed as it contains a motif shown to be a protein scission motif in some members of this family (PMID: 11973329). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(237175) G protein-coupled receptor 64
Rat(266735) G protein-coupled receptor 64
chicken(418611) G protein-coupled receptor 64
dog(491763) G protein-coupled receptor 64
Horse(100058260) G protein-coupled receptor 64
cow(100299135) G protein-coupled receptor 64
domestic cat(101100786) G protein-coupled receptor 64
sheep(101109070) G protein-coupled receptor 64
Domestic Rabbit(100355893) G protein-coupled receptor 64
domestic guinea pig(100733770) G protein-coupled receptor 64
naked mole-rat(101715075) G protein-coupled receptor 64
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005756 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095541 MISSION® esiRNA esiRNA human GPR64 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079858 Rosetta Predictions human pricing
NM_001079859 Rosetta Predictions human pricing
NM_001079860 Rosetta Predictions human pricing
NM_005756 Rosetta Predictions human pricing
NM_181366 Rosetta Predictions rat pricing
NM_001079847 Rosetta Predictions mouse pricing
NM_001079848 Rosetta Predictions mouse pricing
NM_001079857 Rosetta Predictions mouse pricing
NM_178712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313920 predicted 1751
2 SASI_Hs02_00313921 predicted 2101
3 SASI_Hs02_00313922 predicted 2827
4 SASI_Hs02_00313923 predicted 3231
5 SASI_Hs02_00313924 predicted 1919
6 SASI_Hs02_00313925 predicted 2894
7 SASI_Hs02_00313926 predicted 1270
8 SASI_Hs02_00313927 predicted 2498
9 SASI_Hs02_00313928 predicted 1467
10 SASI_Hs02_00313929 predicted 2957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313930 predicted 1710
2 SASI_Hs02_00313931 predicted 2057
3 SASI_Hs02_00313932 predicted 2782
4 SASI_Hs02_00313933 predicted 3193
5 SASI_Hs02_00313934 predicted 1872
6 SASI_Hs02_00313935 predicted 2846
7 SASI_Hs02_00313936 predicted 1231
8 SASI_Hs02_00313937 predicted 2456
9 SASI_Hs02_00313938 predicted 1428
10 SASI_Hs02_00313939 predicted 2906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313940 predicted 1684
2 SASI_Hs02_00313941 predicted 2035
3 SASI_Hs02_00313942 predicted 2755
4 SASI_Hs02_00313943 predicted 3165
5 SASI_Hs02_00313944 predicted 1845
6 SASI_Hs02_00313945 predicted 2820
7 SASI_Hs02_00313946 predicted 1210
8 SASI_Hs02_00313947 predicted 2429
9 SASI_Hs02_00313948 predicted 1398
10 SASI_Hs02_00313949 predicted 2883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032549 predicted 1743
2 SASI_Hs01_00032550 predicted 2090
3 SASI_Hs01_00032551 predicted 2815
4 SASI_Hs02_00340226 predicted 3230
5 SASI_Hs02_00340227 predicted 1902
6 SASI_Hs02_00340228 predicted 2885
7 SASI_Hs01_00032554 predicted 1261
8 SASI_Hs01_00032556 predicted 2482
9 SASI_Hs01_00032558 predicted 1463
10 SASI_Hs02_00340229 predicted 2946
11 SASI_Hs01_00032552 predicted 280
12 SASI_Hs01_00032553 predicted 3089
13 SASI_Hs01_00032555 predicted 355
14 SASI_Hs01_00032557 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096653 predicted 426
2 SASI_Rn02_00269692 predicted 1403
3 SASI_Rn01_00096654 predicted 3068
4 SASI_Rn01_00096655 predicted 1869
5 SASI_Rn02_00269693 predicted 1646
6 SASI_Rn01_00096657 predicted 1186
7 SASI_Rn01_00096658 predicted 2860
8 SASI_Rn01_00096659 predicted 530
9 SASI_Rn02_00269694 predicted 1675
10 SASI_Rn02_00269695 predicted 2177
11 SASI_Rn01_00096656 predicted 759
12 SASI_Rn01_00096660 predicted 528
13 SASI_Rn01_00096661 predicted 548
14 SASI_Rn01_00096662 predicted 2275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079847 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293102 predicted 3056
2 SASI_Mm02_00293103 predicted 1387
3 SASI_Mm02_00293104 predicted 638
4 SASI_Mm02_00293105 predicted 1630
5 SASI_Mm02_00293106 predicted 2395
6 SASI_Mm02_00293107 predicted 538
7 SASI_Mm02_00293108 predicted 1911
8 SASI_Mm02_00293109 predicted 1856
9 SASI_Mm02_00293110 predicted 1770
10 SASI_Mm02_00293111 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079848 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293112 predicted 3022
2 SASI_Mm02_00293113 predicted 1357
3 SASI_Mm02_00293114 predicted 609
4 SASI_Mm02_00293115 predicted 1595
5 SASI_Mm02_00293116 predicted 2369
6 SASI_Mm02_00293117 predicted 503
7 SASI_Mm02_00293118 predicted 1875
8 SASI_Mm02_00293119 predicted 1833
9 SASI_Mm02_00293120 predicted 1736
10 SASI_Mm02_00293121 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293132 predicted 641
2 SASI_Mm02_00293133 predicted 1641
3 SASI_Mm02_00293134 predicted 538
4 SASI_Mm02_00293135 predicted 2405
5 SASI_Mm02_00293136 predicted 540
6 SASI_Mm02_00293137 predicted 1919
7 SASI_Mm02_00293138 predicted 527
8 SASI_Mm02_00293139 predicted 1866
9 SASI_Mm02_00293140 predicted 1774
10 SASI_Mm02_00293141 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349219 predicted 3109
2 SASI_Mm01_00164895 predicted 1440
3 SASI_Mm01_00164896 predicted 690
4 SASI_Mm01_00164897 predicted 1679
5 SASI_Mm01_00164899 predicted 2455
6 SASI_Mm01_00164900 predicted 585
7 SASI_Mm01_00164901 predicted 1963
8 SASI_Mm01_00164903 predicted 1915
9 SASI_Mm01_00164904 predicted 1818
10 SASI_Mm02_00349220 predicted 1390
11 SASI_Mm01_00164898 predicted 549
12 SASI_Mm01_00164902 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178712
GPR64 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 64
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178712.3-1839s21c1
Sequence:CCGGCTGATGGCTGTTCCGTCAAAGCTCGAGCTTTGACGGAACAGCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178712.3-2443s21c1
Sequence:CCGGTATCACGGTTGTGGGATATTTCTCGAGAAATATCCCACAACCGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178712.3-3535s21c1
Sequence:CCGGTTCAGTCTGTTGGTAAGTTTACTCGAGTAAACTTACCAACAGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178712.3-2510s21c1
Sequence:CCGCGTTCAGCTCTGTCGAATTAAACTCGAGTTTAATTCGACAGAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-3076s1c1
Sequence:CCGGGCTTACACTTTATCGAGCAAACTCGAGTTTGCTCGATAAAGTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-2105s1c1
Sequence:CCGGGCTGTATAATACCCGAGGTTTCTCGAGAAACCTCGGGTATTATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-1926s1c1
Sequence:CCGGGCTCTGACATTTATCACGTATCTCGAGATACGTGATAAATGTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178712.2-3689s1c1
Sequence:CCGGCCTCCTTTAGAAGATCATATACTCGAGTATATGATCTTCTAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-2640s1c1
Sequence:CCGGGCCATCTTTAACACCTTACAACTCGAGTTGTAAGGTGTTAAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178712
GPR64 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 64
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178712.3-1839s21c1
Sequence:CCGGCTGATGGCTGTTCCGTCAAAGCTCGAGCTTTGACGGAACAGCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178712.3-2443s21c1
Sequence:CCGGTATCACGGTTGTGGGATATTTCTCGAGAAATATCCCACAACCGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178712.3-3535s21c1
Sequence:CCGGTTCAGTCTGTTGGTAAGTTTACTCGAGTAAACTTACCAACAGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178712.3-2510s21c1
Sequence:CCGCGTTCAGCTCTGTCGAATTAAACTCGAGTTTAATTCGACAGAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-3076s1c1
Sequence:CCGGGCTTACACTTTATCGAGCAAACTCGAGTTTGCTCGATAAAGTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-2105s1c1
Sequence:CCGGGCTGTATAATACCCGAGGTTTCTCGAGAAACCTCGGGTATTATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-1926s1c1
Sequence:CCGGGCTCTGACATTTATCACGTATCTCGAGATACGTGATAAATGTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178712.2-3689s1c1
Sequence:CCGGCCTCCTTTAGAAGATCATATACTCGAGTATATGATCTTCTAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-2640s1c1
Sequence:CCGGGCCATCTTTAACACCTTACAACTCGAGTTGTAAGGTGTTAAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178712
GPR64 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 64
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178712.3-1839s21c1
Sequence:CCGGCTGATGGCTGTTCCGTCAAAGCTCGAGCTTTGACGGAACAGCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178712.3-2443s21c1
Sequence:CCGGTATCACGGTTGTGGGATATTTCTCGAGAAATATCCCACAACCGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178712.3-3535s21c1
Sequence:CCGGTTCAGTCTGTTGGTAAGTTTACTCGAGTAAACTTACCAACAGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178712.3-2510s21c1
Sequence:CCGCGTTCAGCTCTGTCGAATTAAACTCGAGTTTAATTCGACAGAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-3076s1c1
Sequence:CCGGGCTTACACTTTATCGAGCAAACTCGAGTTTGCTCGATAAAGTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-2105s1c1
Sequence:CCGGGCTGTATAATACCCGAGGTTTCTCGAGAAACCTCGGGTATTATACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-1926s1c1
Sequence:CCGGGCTCTGACATTTATCACGTATCTCGAGATACGTGATAAATGTCAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178712.2-3689s1c1
Sequence:CCGGCCTCCTTTAGAAGATCATATACTCGAGTATATGATCTTCTAAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178712.2-2640s1c1
Sequence:CCGGGCCATCTTTAACACCTTACAACTCGAGTTGTAAGGTGTTAAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005756
VALIDATED
GPR64 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 64
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005756.2-2516s21c1
Sequence:CCGGCATTACGGTGGTGGGATATTTCTCGAGAAATATCCCACCACCGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005756.2-3335s21c1
Sequence:CCGGGCTAATTAAGGGCGATGATTACTCGAGTAATCATCGCCCTTAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005756.2-2582s21c1
Sequence:CCGGGGTTCAGCTCTGTCGAATTAACTCGAGTTAATTCGACAGAGCTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005756.1-2656s1c1
Sequence:CCGGGCCATCTTTAATACCTTACAACTCGAGTTGTAAGGTATTAAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005756.1-220s1c1
Sequence:CCGGCCACCTGCTAAATTATCTGTTCTCGAGAACAGATAATTTAGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005756.1-675s1c1
Sequence:CCGGCGCTTTGGAAAGAGTAAAGATCTCGAGATCTTTACTCTTTCCAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005756.1-3092s1c1
Sequence:CCGGGCTTACACTTTATTGAGCAAACTCGAGTTTGCTCAATAAAGTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005756.1-3710s1c1
Sequence:CCGGCCTCAGTGAAATCAAGAAATACTCGAGTATTTCTTGATTTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005756
VALIDATED
GPR64 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 64
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005756.2-2516s21c1
Sequence:CCGGCATTACGGTGGTGGGATATTTCTCGAGAAATATCCCACCACCGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005756.2-3335s21c1
Sequence:CCGGGCTAATTAAGGGCGATGATTACTCGAGTAATCATCGCCCTTAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005756.2-2582s21c1
Sequence:CCGGGGTTCAGCTCTGTCGAATTAACTCGAGTTAATTCGACAGAGCTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005756.1-2656s1c1
Sequence:CCGGGCCATCTTTAATACCTTACAACTCGAGTTGTAAGGTATTAAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005756.1-220s1c1
Sequence:CCGGCCACCTGCTAAATTATCTGTTCTCGAGAACAGATAATTTAGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005756.1-675s1c1
Sequence:CCGGCGCTTTGGAAAGAGTAAAGATCTCGAGATCTTTACTCTTTCCAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005756.1-3092s1c1
Sequence:CCGGGCTTACACTTTATTGAGCAAACTCGAGTTTGCTCAATAAAGTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005756.1-3710s1c1
Sequence:CCGGCCTCAGTGAAATCAAGAAATACTCGAGTATTTCTTGATTTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005756
VALIDATED
GPR64 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 64
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_005756.2-2516s21c1
Sequence:CCGGCATTACGGTGGTGGGATATTTCTCGAGAAATATCCCACCACCGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005756.2-3335s21c1
Sequence:CCGGGCTAATTAAGGGCGATGATTACTCGAGTAATCATCGCCCTTAATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005756.2-2582s21c1
Sequence:CCGGGGTTCAGCTCTGTCGAATTAACTCGAGTTAATTCGACAGAGCTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005756.1-2656s1c1
Sequence:CCGGGCCATCTTTAATACCTTACAACTCGAGTTGTAAGGTATTAAAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005756.1-220s1c1
Sequence:CCGGCCACCTGCTAAATTATCTGTTCTCGAGAACAGATAATTTAGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005756.1-675s1c1
Sequence:CCGGCGCTTTGGAAAGAGTAAAGATCTCGAGATCTTTACTCTTTCCAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005756.1-3092s1c1
Sequence:CCGGGCTTACACTTTATTGAGCAAACTCGAGTTTGCTCAATAAAGTGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005756.1-3710s1c1
Sequence:CCGGCCTCAGTGAAATCAAGAAATACTCGAGTATTTCTTGATTTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks