EMAIL THIS PAGE TO A FRIEND

GPR65

G protein-coupled receptor 65

54 Gene Product Result for
Synonyms: TDAG8 hTDAG8
UniProtKB ID: Q8IYL9, O75819
Gene ID:
Mouse(14744) G-protein coupled receptor 65
Rat(299242) G-protein coupled receptor 65
domestic guinea pig(100722733) G protein-coupled receptor 65
naked mole-rat(101721535) G protein-coupled receptor 65
sheep(101118361) G protein-coupled receptor 65
Zebrafish(100537038) G protein-coupled receptor 65
chicken(423395) G protein-coupled receptor 65
cow(788507) G protein-coupled receptor 65
domestic cat(101091206) G protein-coupled receptor 65
dog(490821) G protein-coupled receptor 65
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003608 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142871 MISSION® esiRNA esiRNA human GPR65 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003608 Rosetta Predictions human pricing
NM_001106751 Rosetta Predictions rat pricing
NM_008152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106388 predicted 611
2 SASI_Hs01_00106389 predicted 1332
3 SASI_Hs01_00106390 predicted 1240
4 SASI_Hs01_00106391 predicted 1251
5 SASI_Hs01_00106393 predicted 1376
6 SASI_Hs01_00106394 predicted 565
7 SASI_Hs02_00335943 predicted 640
8 SASI_Hs01_00106395 predicted 1411
9 SASI_Hs01_00106396 predicted 1210
10 SASI_Hs01_00106397 predicted 611
11 SASI_Hs01_00106392 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222038 predicted 694
2 SASI_Rn02_00222039 predicted 536
3 SASI_Rn02_00222040 predicted 208
4 SASI_Rn02_00222041 predicted 563
5 SASI_Rn02_00222042 predicted 695
6 SASI_Rn02_00222043 predicted 324
7 SASI_Rn02_00222044 predicted 764
8 SASI_Rn02_00222045 predicted 320
9 SASI_Rn02_00222046 predicted 332
10 SASI_Rn02_00222047 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313251 predicted 590
2 SASI_Mm01_00159217 predicted 1599
3 SASI_Mm01_00159218 predicted 1511
4 SASI_Mm01_00159219 predicted 646
5 SASI_Mm01_00159221 predicted 907
6 SASI_Mm01_00159222 predicted 1257
7 SASI_Mm01_00159223 predicted 706
8 SASI_Mm01_00159224 predicted 1464
9 SASI_Mm01_00159225 predicted 1194
10 SASI_Mm02_00313252 predicted 876
11 SASI_Mm01_00159220 predicted 1086
12 SASI_Mm01_00159226 predicted 1077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008152
GPR65 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 65
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-597s1c1
Sequence:CCGGCGGATCTTTATGCGTATCCTTCTCGAGAAGGATACGCATAAAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-1469s1c1
Sequence:CCGGCCACAAGAGATGCTGTAGAATCTCGAGATTCTACAGCATCTCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-586s1c1
Sequence:CCGGCCAGCCAACATCGGATCTTTACTCGAGTAAAGATCCGATGTTGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-752s1c1
Sequence:CCGGCCTTGTGCAAAGGAAGCGTTTCTCGAGAAACGCTTCCTTTGCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-819s21c1
Sequence:CCGGCATTGCCCTGGACCGCTATTTCTCGAGAAATAGCGGTCCAGGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-1060s21c1
Sequence:CCGGACGTGCATGGGCTACGCAATACTCGAGTATTGCGTAGCCCATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-877s21c1
Sequence:CCGGACGAGAAGATTCGCGTTTATTCTCGAGAATAAACGCGAATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008152.2-1519s21c1
Sequence:CCGGGGTTAAGTTACATGGTATTATCTCGAGATAATACCATGTAACTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-1256s21c1
Sequence:CCGGAGCGCGACATGAACGTCAATGCTCGAGCATTGACGTTCATGTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008152
GPR65 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 65
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-597s1c1
Sequence:CCGGCGGATCTTTATGCGTATCCTTCTCGAGAAGGATACGCATAAAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-1469s1c1
Sequence:CCGGCCACAAGAGATGCTGTAGAATCTCGAGATTCTACAGCATCTCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-586s1c1
Sequence:CCGGCCAGCCAACATCGGATCTTTACTCGAGTAAAGATCCGATGTTGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-752s1c1
Sequence:CCGGCCTTGTGCAAAGGAAGCGTTTCTCGAGAAACGCTTCCTTTGCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-819s21c1
Sequence:CCGGCATTGCCCTGGACCGCTATTTCTCGAGAAATAGCGGTCCAGGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-1060s21c1
Sequence:CCGGACGTGCATGGGCTACGCAATACTCGAGTATTGCGTAGCCCATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-877s21c1
Sequence:CCGGACGAGAAGATTCGCGTTTATTCTCGAGAATAAACGCGAATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008152.2-1519s21c1
Sequence:CCGGGGTTAAGTTACATGGTATTATCTCGAGATAATACCATGTAACTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-1256s21c1
Sequence:CCGGAGCGCGACATGAACGTCAATGCTCGAGCATTGACGTTCATGTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008152
GPR65 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 65
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-597s1c1
Sequence:CCGGCGGATCTTTATGCGTATCCTTCTCGAGAAGGATACGCATAAAGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-1469s1c1
Sequence:CCGGCCACAAGAGATGCTGTAGAATCTCGAGATTCTACAGCATCTCTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-586s1c1
Sequence:CCGGCCAGCCAACATCGGATCTTTACTCGAGTAAAGATCCGATGTTGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008152.1-752s1c1
Sequence:CCGGCCTTGTGCAAAGGAAGCGTTTCTCGAGAAACGCTTCCTTTGCACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-819s21c1
Sequence:CCGGCATTGCCCTGGACCGCTATTTCTCGAGAAATAGCGGTCCAGGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-1060s21c1
Sequence:CCGGACGTGCATGGGCTACGCAATACTCGAGTATTGCGTAGCCCATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-877s21c1
Sequence:CCGGACGAGAAGATTCGCGTTTATTCTCGAGAATAAACGCGAATCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238234    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008152.2-1519s21c1
Sequence:CCGGGGTTAAGTTACATGGTATTATCTCGAGATAATACCATGTAACTTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008152.2-1256s21c1
Sequence:CCGGAGCGCGACATGAACGTCAATGCTCGAGCATTGACGTTCATGTCGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003608
GPR65 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 65
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-850s1c1
Sequence:CCGGGCATTGCCGTTGATCGGTATTCTCGAGAATACCGATCAACGGCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003608.2-1562s1c1
Sequence:CCGGAGGGAAGGGAAGTTTAAGTTACTCGAGTAACTTAAACTTCCCTTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-1161s1c1
Sequence:CCGGCGGCACAATAAAGCCACGGAACTCGAGTTCCGTGGCTTTATTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-727s1c1
Sequence:CCGGCTCTCCCTTTATGGATTGATTCTCGAGAATCAATCCATAAAGGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-1354s1c1
Sequence:CCGGCGGTTGCATTAACAAGTTTAACTCGAGTTAAACTTGTTAATGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003608.2-1151s21c1
Sequence:CCGGCCAAGCTGTGCGGCACAATAACTCGAGTTATTGTGCCGCACAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003608.2-558s21c1
Sequence:CCGGCATGACCTGGATCACTATTTGCTCGAGCAAATAGTGATCCAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003608.2-851s21c1
Sequence:CCGGCATTGCCGTTGATCGGTATTTCTCGAGAAATACCGATCAACGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003608
GPR65 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 65
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-850s1c1
Sequence:CCGGGCATTGCCGTTGATCGGTATTCTCGAGAATACCGATCAACGGCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003608.2-1562s1c1
Sequence:CCGGAGGGAAGGGAAGTTTAAGTTACTCGAGTAACTTAAACTTCCCTTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-1161s1c1
Sequence:CCGGCGGCACAATAAAGCCACGGAACTCGAGTTCCGTGGCTTTATTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-727s1c1
Sequence:CCGGCTCTCCCTTTATGGATTGATTCTCGAGAATCAATCCATAAAGGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-1354s1c1
Sequence:CCGGCGGTTGCATTAACAAGTTTAACTCGAGTTAAACTTGTTAATGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003608.2-1151s21c1
Sequence:CCGGCCAAGCTGTGCGGCACAATAACTCGAGTTATTGTGCCGCACAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003608.2-558s21c1
Sequence:CCGGCATGACCTGGATCACTATTTGCTCGAGCAAATAGTGATCCAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003608.2-851s21c1
Sequence:CCGGCATTGCCGTTGATCGGTATTTCTCGAGAAATACCGATCAACGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003608
GPR65 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 65
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-850s1c1
Sequence:CCGGGCATTGCCGTTGATCGGTATTCTCGAGAATACCGATCAACGGCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003608.2-1562s1c1
Sequence:CCGGAGGGAAGGGAAGTTTAAGTTACTCGAGTAACTTAAACTTCCCTTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-1161s1c1
Sequence:CCGGCGGCACAATAAAGCCACGGAACTCGAGTTCCGTGGCTTTATTGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-727s1c1
Sequence:CCGGCTCTCCCTTTATGGATTGATTCTCGAGAATCAATCCATAAAGGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003608.2-1354s1c1
Sequence:CCGGCGGTTGCATTAACAAGTTTAACTCGAGTTAAACTTGTTAATGCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003608.2-1151s21c1
Sequence:CCGGCCAAGCTGTGCGGCACAATAACTCGAGTTATTGTGCCGCACAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003608.2-558s21c1
Sequence:CCGGCATGACCTGGATCACTATTTGCTCGAGCAAATAGTGATCCAGGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003608.2-851s21c1
Sequence:CCGGCATTGCCGTTGATCGGTATTTCTCGAGAAATACCGATCAACGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks