EMAIL THIS PAGE TO A FRIEND

GPR68

G protein-coupled receptor 68

Synonyms: GPR12A OGR1
UniProtKB ID: Q15743, Q13334, Q4VBB4, Q6IX34
Gene ID:
Mouse(238377) G protein-coupled receptor 68
Rat(314386) G protein-coupled receptor 68
chicken(428904) G protein-coupled receptor 68
cow(281799) G protein-coupled receptor 68
Horse(100053071) G protein-coupled receptor 68
domestic cat(101095587) G protein-coupled receptor 68
dog(100688992) G protein-coupled receptor 68
sheep(101111492) G protein-coupled receptor 68
Domestic Rabbit(100348269) G protein-coupled receptor 68
domestic guinea pig(100735382) G protein-coupled receptor 68
naked mole-rat(101711465) G protein-coupled receptor 68
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003485 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175493 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175493 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175493 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003485 Rosetta Predictions human pricing
NM_001108049 Rosetta Predictions rat pricing
NM_175493 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119648 predicted 462
2 SASI_Hs02_00335759 predicted 831
3 SASI_Hs01_00119649 predicted 450
4 SASI_Hs01_00119650 predicted 837
5 SASI_Hs01_00119651 predicted 301
6 SASI_Hs01_00119652 predicted 1143
7 SASI_Hs01_00119653 predicted 1292
8 SASI_Hs01_00119654 predicted 1409
9 SASI_Hs01_00119655 predicted 751
10 SASI_Hs01_00119656 predicted 1059
11 SASI_Hs01_00119657 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234845 predicted 1233
2 SASI_Rn02_00234846 predicted 1138
3 SASI_Rn02_00234847 predicted 839
4 SASI_Rn02_00234848 predicted 852
5 SASI_Rn02_00234849 predicted 948
6 SASI_Rn02_00234850 predicted 1908
7 SASI_Rn02_00234851 predicted 2157
8 SASI_Rn02_00234852 predicted 1461
9 SASI_Rn02_00234853 predicted 794
10 SASI_Rn02_00234854 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175493 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098083 predicted 593
2 SASI_Mm01_00098084 predicted 835
3 SASI_Mm01_00098085 predicted 1751
4 SASI_Mm01_00098086 predicted 1433
5 SASI_Mm01_00098087 predicted 496
6 SASI_Mm01_00098088 predicted 1692
7 SASI_Mm01_00098089 predicted 1623
8 SASI_Mm01_00098090 predicted 1330
9 SASI_Mm01_00098091 predicted 1491
10 SASI_Mm01_00098092 predicted 872
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003485
GPR68 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 68
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003485.3-1750s21c1
Sequence:CCGGCCACCGTTGTCACAGACAATGCTCGAGCATTGTCTGTGACAACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-328s21c1
Sequence:CCGGGAGCTGTACCATCGACCATACCTCGAGGTATGGTCGATGGTACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-300s21c1
Sequence:CCGGGGAACATCACTGCAGACAACTCTCGAGAGTTGTCTGCAGTGATGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-588s21c1
Sequence:CCGGGCATCCTCCTGTACGAGAACACTCGAGTGTTCTCGTACAGGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-428s21c1
Sequence:CCGGTTCGGCTACCTGCAGATCAAGCTCGAGCTTGATCTGCAGGTAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-889s1c1
Sequence:CCGGCGCCATCAACTACTACCGCTTCTCGAGAAGCGGTAGTAGTTGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-847s1c1
Sequence:CCGGCCGCGTGTGCTTTGAGCACTACTCGAGTAGTGCTCAAAGCACACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-1354s1c1
Sequence:CCGGCGAGCTGTTGACCAAGCTCCACTCGAGTGGAGCTTGGTCAACAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-460s1c1
Sequence:CCGGCCTGTCCCTCTACTTCGGCTACTCGAGTAGCCGAAGTAGAGGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-640s1c1
Sequence:CCGGCCTGTACGAGAACATCTACATCTCGAGATGTAGATGTTCTCGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003485
GPR68 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 68
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003485.3-1750s21c1
Sequence:CCGGCCACCGTTGTCACAGACAATGCTCGAGCATTGTCTGTGACAACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-328s21c1
Sequence:CCGGGAGCTGTACCATCGACCATACCTCGAGGTATGGTCGATGGTACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-300s21c1
Sequence:CCGGGGAACATCACTGCAGACAACTCTCGAGAGTTGTCTGCAGTGATGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-588s21c1
Sequence:CCGGGCATCCTCCTGTACGAGAACACTCGAGTGTTCTCGTACAGGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-428s21c1
Sequence:CCGGTTCGGCTACCTGCAGATCAAGCTCGAGCTTGATCTGCAGGTAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-889s1c1
Sequence:CCGGCGCCATCAACTACTACCGCTTCTCGAGAAGCGGTAGTAGTTGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-847s1c1
Sequence:CCGGCCGCGTGTGCTTTGAGCACTACTCGAGTAGTGCTCAAAGCACACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-1354s1c1
Sequence:CCGGCGAGCTGTTGACCAAGCTCCACTCGAGTGGAGCTTGGTCAACAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-460s1c1
Sequence:CCGGCCTGTCCCTCTACTTCGGCTACTCGAGTAGCCGAAGTAGAGGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-640s1c1
Sequence:CCGGCCTGTACGAGAACATCTACATCTCGAGATGTAGATGTTCTCGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003485
GPR68 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 68
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003485.3-1750s21c1
Sequence:CCGGCCACCGTTGTCACAGACAATGCTCGAGCATTGTCTGTGACAACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-328s21c1
Sequence:CCGGGAGCTGTACCATCGACCATACCTCGAGGTATGGTCGATGGTACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-300s21c1
Sequence:CCGGGGAACATCACTGCAGACAACTCTCGAGAGTTGTCTGCAGTGATGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-588s21c1
Sequence:CCGGGCATCCTCCTGTACGAGAACACTCGAGTGTTCTCGTACAGGAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003485.3-428s21c1
Sequence:CCGGTTCGGCTACCTGCAGATCAAGCTCGAGCTTGATCTGCAGGTAGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-889s1c1
Sequence:CCGGCGCCATCAACTACTACCGCTTCTCGAGAAGCGGTAGTAGTTGATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-847s1c1
Sequence:CCGGCCGCGTGTGCTTTGAGCACTACTCGAGTAGTGCTCAAAGCACACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-1354s1c1
Sequence:CCGGCGAGCTGTTGACCAAGCTCCACTCGAGTGGAGCTTGGTCAACAGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-460s1c1
Sequence:CCGGCCTGTCCCTCTACTTCGGCTACTCGAGTAGCCGAAGTAGAGGGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003485.2-640s1c1
Sequence:CCGGCCTGTACGAGAACATCTACATCTCGAGATGTAGATGTTCTCGTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175493
GPR68 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 68
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-462s1c1
Sequence:CCGGCTTCGGGTACTTGCAGATCAACTCGAGTTGATCTGCAAGTACCCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-627s1c1
Sequence:CCGGCCTCCTCTATGAGAACATTTACTCGAGTAAATGTTCTCATAGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-798s1c1
Sequence:CCGGCCTCAATCACAAGGAGGTCATCTCGAGATGACCTCCTTGTGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-1334s1c1
Sequence:CCGGGCGAGGAACCTGAATTGTTAACTCGAGTTAACAATTCAGGTTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-873s1c1
Sequence:CCGGGCAGCGTAGCATCAACTACTACTCGAGTAGTAGTTGATGCTACGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175493
GPR68 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 68
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-462s1c1
Sequence:CCGGCTTCGGGTACTTGCAGATCAACTCGAGTTGATCTGCAAGTACCCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-627s1c1
Sequence:CCGGCCTCCTCTATGAGAACATTTACTCGAGTAAATGTTCTCATAGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-798s1c1
Sequence:CCGGCCTCAATCACAAGGAGGTCATCTCGAGATGACCTCCTTGTGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-1334s1c1
Sequence:CCGGGCGAGGAACCTGAATTGTTAACTCGAGTTAACAATTCAGGTTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-873s1c1
Sequence:CCGGGCAGCGTAGCATCAACTACTACTCGAGTAGTAGTTGATGCTACGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175493
GPR68 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 68
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-462s1c1
Sequence:CCGGCTTCGGGTACTTGCAGATCAACTCGAGTTGATCTGCAAGTACCCGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-627s1c1
Sequence:CCGGCCTCCTCTATGAGAACATTTACTCGAGTAAATGTTCTCATAGAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-798s1c1
Sequence:CCGGCCTCAATCACAAGGAGGTCATCTCGAGATGACCTCCTTGTGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-1334s1c1
Sequence:CCGGGCGAGGAACCTGAATTGTTAACTCGAGTTAACAATTCAGGTTCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175493.2-873s1c1
Sequence:CCGGGCAGCGTAGCATCAACTACTACTCGAGTAGTAGTTGATGCTACGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks