EMAIL THIS PAGE TO A FRIEND

GPR6

G protein-coupled receptor 6

96 Gene Product Result for
UniProtKB ID: P46095, Q17RJ7, Q5SYL0
Gene ID:
Mouse(140741) G protein-coupled receptor 6
Rat(83683) G protein-coupled receptor 6
chicken(428625) G protein-coupled receptor 6
dog(481959) G protein-coupled receptor 6
chicken(101747493) G protein-coupled receptor 6
cow(506661) G protein-coupled receptor 6
domestic cat(101080537) G protein-coupled receptor 6
chicken(101668457) G protein-coupled receptor 6
sheep(101112988) G protein-coupled receptor 6
domestic guinea pig(100715867) G protein-coupled receptor 6
naked mole-rat(101704943) G protein-coupled receptor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100962 Anti-GPR6 antibody produced in rabbit affinity isolated antibody bovine, mouse, human, rat
western blot pricing
SAB2900467 Anti-GPR6 antibody produced in rabbit affinity isolated antibody bovine, mouse, rat, human, rabbit, pig, monkey, hamster, dog
immunohistochemistry pricing
SAB2900468 Anti-GPR6 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199058 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199058 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199058 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005284 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032511 MISSION® esiRNA esiRNA human GPR6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005284 Rosetta Predictions human pricing
NM_031806 Rosetta Predictions rat pricing
NM_199058 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040598 predicted 1383
2 SASI_Hs01_00040599 predicted 522
3 SASI_Hs01_00040600 predicted 496
4 SASI_Hs01_00040601 predicted 1171
5 SASI_Hs01_00040602 predicted 1178
6 SASI_Hs01_00040603 predicted 380
7 SASI_Hs01_00040604 predicted 1352
8 SASI_Hs01_00040605 predicted 510
9 SASI_Hs01_00040606 predicted 838
10 SASI_Hs02_00339336 predicted 1274
11 SASI_Hs01_00040597 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074526 predicted 1530
2 SASI_Rn01_00074528 predicted 1107
3 SASI_Rn02_00265262 predicted 1576
4 SASI_Rn01_00074529 predicted 1705
5 SASI_Rn01_00074530 predicted 624
6 SASI_Rn01_00074531 predicted 648
7 SASI_Rn01_00074532 predicted 1567
8 SASI_Rn01_00074533 predicted 755
9 SASI_Rn01_00074534 predicted 1536
10 SASI_Rn01_00074535 predicted 1031
11 SASI_Rn01_00074527 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199058 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182801 predicted 225
2 SASI_Mm02_00351335 predicted 678
3 SASI_Mm01_00182802 predicted 498
4 SASI_Mm01_00182803 predicted 807
5 SASI_Mm01_00182804 predicted 541
6 SASI_Mm01_00182805 predicted 718
7 SASI_Mm01_00182806 predicted 826
8 SASI_Mm01_00182807 predicted 246
9 SASI_Mm01_00182808 predicted 214
10 SASI_Mm01_00182809 predicted 367
11 SASI_Mm01_00182810 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199058
GPR6 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199058.1-728s21c1
Sequence:CCGGTGCACTTGTACGTGCGCATCTCTCGAGAGATGCGCACGTACAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199058.1-515s21c1
Sequence:CCGGACAACGCGCTCACCTACTACTCTCGAGAGTAGTAGGTGAGCGCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-375s1c1
Sequence:CCGGCCTCATCTTACACTTCGTGTTCTCGAGAACACGAAGTGTAAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-930s1c1
Sequence:CCGGCTACACTTATGCCACCCTGTTCTCGAGAACAGGGTGGCATAAGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-483s1c1
Sequence:CCGGTGCTATCACAGTGGACCGTTACTCGAGTAACGGTCCACTGTGATAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-251s1c1
Sequence:CCGGGAACTGTGATCGCAGGCGAAACTCGAGTTTCGCCTGCGATCACAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-781s1c1
Sequence:CCGGGCTTTGCAACAGCATTGCCTACTCGAGTAGGCAATGCTGTTGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199058
GPR6 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199058.1-728s21c1
Sequence:CCGGTGCACTTGTACGTGCGCATCTCTCGAGAGATGCGCACGTACAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199058.1-515s21c1
Sequence:CCGGACAACGCGCTCACCTACTACTCTCGAGAGTAGTAGGTGAGCGCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-375s1c1
Sequence:CCGGCCTCATCTTACACTTCGTGTTCTCGAGAACACGAAGTGTAAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-930s1c1
Sequence:CCGGCTACACTTATGCCACCCTGTTCTCGAGAACAGGGTGGCATAAGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-483s1c1
Sequence:CCGGTGCTATCACAGTGGACCGTTACTCGAGTAACGGTCCACTGTGATAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-251s1c1
Sequence:CCGGGAACTGTGATCGCAGGCGAAACTCGAGTTTCGCCTGCGATCACAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-781s1c1
Sequence:CCGGGCTTTGCAACAGCATTGCCTACTCGAGTAGGCAATGCTGTTGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199058
GPR6 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199058.1-728s21c1
Sequence:CCGGTGCACTTGTACGTGCGCATCTCTCGAGAGATGCGCACGTACAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199058.1-515s21c1
Sequence:CCGGACAACGCGCTCACCTACTACTCTCGAGAGTAGTAGGTGAGCGCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-375s1c1
Sequence:CCGGCCTCATCTTACACTTCGTGTTCTCGAGAACACGAAGTGTAAGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-930s1c1
Sequence:CCGGCTACACTTATGCCACCCTGTTCTCGAGAACAGGGTGGCATAAGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-483s1c1
Sequence:CCGGTGCTATCACAGTGGACCGTTACTCGAGTAACGGTCCACTGTGATAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-251s1c1
Sequence:CCGGGAACTGTGATCGCAGGCGAAACTCGAGTTTCGCCTGCGATCACAGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199058.1-781s1c1
Sequence:CCGGGCTTTGCAACAGCATTGCCTACTCGAGTAGGCAATGCTGTTGCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005284
GPR6 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005284.3-400s21c1
Sequence:CCGGCACTTTGTGTTCCAGTACTTGCTCGAGCAAGTACTGGAACACAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005284.3-1387s21c1
Sequence:CCGGGATATGGTTGTATACTCAAATCTCGAGATTTGAGTATACAACCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005284.3-528s21c1
Sequence:CCGGGTATAACGCGCTCACCTATTACTCGAGTAATAGGTGAGCGCGTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005284.3-1433s21c1
Sequence:CCGGACATTCCAATACTGCTTAATTCTCGAGAATTAAGCAGTATTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005284.2-1422s1c1
Sequence:CCGGCGTTTGTCAAACGAAGACATTCTCGAGAATGTCTTCGTTTGACAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-390s1c1
Sequence:CCGGTGTGGCCTCATCTTGCACTTTCTCGAGAAAGTGCAAGATGAGGCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-404s1c1
Sequence:CCGGGCACTTTGTGTTCCAGTACTTCTCGAGAAGTACTGGAACACAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-530s1c1
Sequence:CCGGCCTGTATAACGCGCTCACCTACTCGAGTAGGTGAGCGCGTTATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-1069s1c1
Sequence:CCGGAGTCCAAAGTGCCCTTTCGTTCTCGAGAACGAAAGGGCACTTTGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005284
GPR6 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005284.3-400s21c1
Sequence:CCGGCACTTTGTGTTCCAGTACTTGCTCGAGCAAGTACTGGAACACAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005284.3-1387s21c1
Sequence:CCGGGATATGGTTGTATACTCAAATCTCGAGATTTGAGTATACAACCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005284.3-528s21c1
Sequence:CCGGGTATAACGCGCTCACCTATTACTCGAGTAATAGGTGAGCGCGTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005284.3-1433s21c1
Sequence:CCGGACATTCCAATACTGCTTAATTCTCGAGAATTAAGCAGTATTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005284.2-1422s1c1
Sequence:CCGGCGTTTGTCAAACGAAGACATTCTCGAGAATGTCTTCGTTTGACAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-390s1c1
Sequence:CCGGTGTGGCCTCATCTTGCACTTTCTCGAGAAAGTGCAAGATGAGGCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-404s1c1
Sequence:CCGGGCACTTTGTGTTCCAGTACTTCTCGAGAAGTACTGGAACACAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-530s1c1
Sequence:CCGGCCTGTATAACGCGCTCACCTACTCGAGTAGGTGAGCGCGTTATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-1069s1c1
Sequence:CCGGAGTCCAAAGTGCCCTTTCGTTCTCGAGAACGAAAGGGCACTTTGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005284
GPR6 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005284.3-400s21c1
Sequence:CCGGCACTTTGTGTTCCAGTACTTGCTCGAGCAAGTACTGGAACACAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005284.3-1387s21c1
Sequence:CCGGGATATGGTTGTATACTCAAATCTCGAGATTTGAGTATACAACCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005284.3-528s21c1
Sequence:CCGGGTATAACGCGCTCACCTATTACTCGAGTAATAGGTGAGCGCGTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005284.3-1433s21c1
Sequence:CCGGACATTCCAATACTGCTTAATTCTCGAGAATTAAGCAGTATTGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005284.2-1422s1c1
Sequence:CCGGCGTTTGTCAAACGAAGACATTCTCGAGAATGTCTTCGTTTGACAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-390s1c1
Sequence:CCGGTGTGGCCTCATCTTGCACTTTCTCGAGAAAGTGCAAGATGAGGCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-404s1c1
Sequence:CCGGGCACTTTGTGTTCCAGTACTTCTCGAGAAGTACTGGAACACAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-530s1c1
Sequence:CCGGCCTGTATAACGCGCTCACCTACTCGAGTAGGTGAGCGCGTTATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005284.2-1069s1c1
Sequence:CCGGAGTCCAAAGTGCCCTTTCGTTCTCGAGAACGAAAGGGCACTTTGGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks