EMAIL THIS PAGE TO A FRIEND

GPR75

G protein-coupled receptor 75

47 Gene Product Result for
Synonyms: GPRchr2 WI31133
UniProtKB ID: O95800, B2RC02, Q6NWR2
Gene ID:
Human(10936) Summary: GPR75 is a member of the G protein-coupled receptor family. GPRs are cell surface receptors that activate guanine-nucleotide binding proteins upon the binding of a ligand.[supplied by OMIM, Jul 2002]
Mouse(237716) G protein-coupled receptor 75
Rat(498434) G protein-coupled receptor 75
domestic guinea pig(100713789) G protein-coupled receptor 75
naked mole-rat(101718312) G protein-coupled receptor 75
Domestic Rabbit(100347723) G protein-coupled receptor 75
chicken(428544) G protein-coupled receptor 75
cow(539470) G protein-coupled receptor 75
Horse(100066961) G protein-coupled receptor 75
domestic cat(101090006) G protein-coupled receptor 75
dog(100688882) G protein-coupled receptor 75
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006794 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121351 MISSION® esiRNA esiRNA human GPR75 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006794 Rosetta Predictions human pricing
NM_001109096 Rosetta Predictions rat pricing
NM_175490 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190996 predicted 600
2 SASI_Hs01_00190997 predicted 1646
3 SASI_Hs01_00190998 predicted 1558
4 SASI_Hs01_00190999 predicted 1329
5 SASI_Hs01_00191000 predicted 1785
6 SASI_Hs01_00191001 predicted 1804
7 SASI_Hs01_00191002 predicted 932
8 SASI_Hs01_00191003 predicted 1708
9 SASI_Hs01_00191004 predicted 1820
10 SASI_Hs01_00191005 predicted 1817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245090 predicted 840
2 SASI_Rn02_00245091 predicted 928
3 SASI_Rn02_00245092 predicted 827
4 SASI_Rn02_00245093 predicted 1719
5 SASI_Rn02_00245094 predicted 1347
6 SASI_Rn02_00245095 predicted 1627
7 SASI_Rn02_00245096 predicted 546
8 SASI_Rn02_00245097 predicted 360
9 SASI_Rn02_00245098 predicted 857
10 SASI_Rn02_00245099 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183410 predicted 1008
2 SASI_Mm01_00183411 predicted 997
3 SASI_Mm01_00183412 predicted 377
4 SASI_Mm01_00183413 predicted 596
5 SASI_Mm01_00183414 predicted 824
6 SASI_Mm01_00183415 predicted 803
7 SASI_Mm01_00183416 predicted 1267
8 SASI_Mm01_00183417 predicted 853
9 SASI_Mm01_00183418 predicted 332
10 SASI_Mm02_00346408 predicted 854
11 SASI_Mm01_00183419 predicted 1353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175490
GPR75 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 75
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-843s1c1
Sequence:CCGGGCACAGTCAAACTCATGGATACTCGAGTATCCATGAGTTTGACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-1451s1c1
Sequence:CCGGGCATCTATAACAGCAGCCCTTCTCGAGAAGGGCTGCTGTTATAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-384s1c1
Sequence:CCGGCGTCATCATGTCCCTCAAGATCTCGAGATCTTGAGGGACATGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-1430s1c1
Sequence:CCGGCTAGGATTGAACCTTACTATACTCGAGTATAGTAAGGTTCAATCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-145s1c1
Sequence:CCGGCTTGCCATCATCTTCTGTCTACTCGAGTAGACAGAAGATGATGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175490
GPR75 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 75
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-843s1c1
Sequence:CCGGGCACAGTCAAACTCATGGATACTCGAGTATCCATGAGTTTGACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-1451s1c1
Sequence:CCGGGCATCTATAACAGCAGCCCTTCTCGAGAAGGGCTGCTGTTATAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-384s1c1
Sequence:CCGGCGTCATCATGTCCCTCAAGATCTCGAGATCTTGAGGGACATGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-1430s1c1
Sequence:CCGGCTAGGATTGAACCTTACTATACTCGAGTATAGTAAGGTTCAATCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-145s1c1
Sequence:CCGGCTTGCCATCATCTTCTGTCTACTCGAGTAGACAGAAGATGATGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175490
GPR75 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 75
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-843s1c1
Sequence:CCGGGCACAGTCAAACTCATGGATACTCGAGTATCCATGAGTTTGACTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-1451s1c1
Sequence:CCGGGCATCTATAACAGCAGCCCTTCTCGAGAAGGGCTGCTGTTATAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-384s1c1
Sequence:CCGGCGTCATCATGTCCCTCAAGATCTCGAGATCTTGAGGGACATGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-1430s1c1
Sequence:CCGGCTAGGATTGAACCTTACTATACTCGAGTATAGTAAGGTTCAATCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175490.3-145s1c1
Sequence:CCGGCTTGCCATCATCTTCTGTCTACTCGAGTAGACAGAAGATGATGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006794
GPR75 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 75
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006794.1-1275s1c1
Sequence:CCGGCCAGTTTGAATTGTTTGGATTCTCGAGAATCCAAACAATTCAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006794.1-1699s1c1
Sequence:CCGGCCATGTAACTTACAGCCAGTACTCGAGTACTGGCTGTAAGTTACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006794.1-1018s1c1
Sequence:CCGGGCTCTGTATAGGAACCAGAATCTCGAGATTCTGGTTCCTATACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006794.2-1937s21c1
Sequence:CCGGCTGATAGTAATGGACTTTATTCTCGAGAATAAAGTCCATTACTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006794.2-1116s21c1
Sequence:CCGGACGTTCAGACCCGTGGATATACTCGAGTATATCCACGGGTCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006794.2-1899s21c1
Sequence:CCGGATGGAGGCTATAGGATCTTATCTCGAGATAAGATCCTATAGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006794.2-1789s21c1
Sequence:CCGGTGGATTTGCCAATTCATATATCTCGAGATATATGAATTGGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006794
GPR75 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 75
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006794.1-1275s1c1
Sequence:CCGGCCAGTTTGAATTGTTTGGATTCTCGAGAATCCAAACAATTCAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006794.1-1699s1c1
Sequence:CCGGCCATGTAACTTACAGCCAGTACTCGAGTACTGGCTGTAAGTTACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006794.1-1018s1c1
Sequence:CCGGGCTCTGTATAGGAACCAGAATCTCGAGATTCTGGTTCCTATACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006794.2-1937s21c1
Sequence:CCGGCTGATAGTAATGGACTTTATTCTCGAGAATAAAGTCCATTACTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006794.2-1116s21c1
Sequence:CCGGACGTTCAGACCCGTGGATATACTCGAGTATATCCACGGGTCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006794.2-1899s21c1
Sequence:CCGGATGGAGGCTATAGGATCTTATCTCGAGATAAGATCCTATAGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006794.2-1789s21c1
Sequence:CCGGTGGATTTGCCAATTCATATATCTCGAGATATATGAATTGGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006794
GPR75 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 75
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006794.1-1275s1c1
Sequence:CCGGCCAGTTTGAATTGTTTGGATTCTCGAGAATCCAAACAATTCAAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006794.1-1699s1c1
Sequence:CCGGCCATGTAACTTACAGCCAGTACTCGAGTACTGGCTGTAAGTTACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006794.1-1018s1c1
Sequence:CCGGGCTCTGTATAGGAACCAGAATCTCGAGATTCTGGTTCCTATACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006794.2-1937s21c1
Sequence:CCGGCTGATAGTAATGGACTTTATTCTCGAGAATAAAGTCCATTACTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006794.2-1116s21c1
Sequence:CCGGACGTTCAGACCCGTGGATATACTCGAGTATATCCACGGGTCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006794.2-1899s21c1
Sequence:CCGGATGGAGGCTATAGGATCTTATCTCGAGATAAGATCCTATAGCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006794.2-1789s21c1
Sequence:CCGGTGGATTTGCCAATTCATATATCTCGAGATATATGAATTGGCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks