EMAIL THIS PAGE TO A FRIEND

GPR78

G protein-coupled receptor 78

UniProtKB ID: Q96P69, Q8NGV3
Gene ID:
Human(27201) Summary: The protein encoded by this gene belongs to the G protein-coupled receptor family, which contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. This is an orphan receptor, which displays significant level of constitutive activity. Association analysis shows preliminary evidence for the involvement of this gene in susceptibility to bipolar affective disorder and schizophrenia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
Zebrafish(557394) G protein-coupled receptor 78
chicken(428798) G protein-coupled receptor 78
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080819 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142451 MISSION® esiRNA esiRNA human GPR78 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080819 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136420 predicted 591
2 SASI_Hs01_00136421 predicted 1379
3 SASI_Hs01_00136422 predicted 649
4 SASI_Hs01_00136423 predicted 1144
5 SASI_Hs01_00136424 predicted 480
6 SASI_Hs01_00136426 predicted 440
7 SASI_Hs01_00136427 predicted 1032
8 SASI_Hs01_00136428 predicted 1382
9 SASI_Hs01_00136429 predicted 1154
10 SASI_Hs02_00362592 predicted 1253
11 SASI_Hs01_00136425 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080819
GPR78 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 78
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080819.2-1140s21c1
Sequence:CCGGAGGAAGATTGGCATTGCTATTCTCGAGAATAGCAATGCCAATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080819.2-1469s21c1
Sequence:CCGGTGTGGACACAGAGAATGATTCCTCGAGGAATCATTCTCTGTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080819.2-1618s1c1
Sequence:CCGGCTTTGAGCTAAGGCTGAAGTACTCGAGTACTTCAGCCTTAGCTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-1161s1c1
Sequence:CCGGGCGACCTTCCTCATCTGCTTTCTCGAGAAAGCAGATGAGGAAGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-1134s1c1
Sequence:CCGGGCCACCAGGAAGATTGGCATTCTCGAGAATGCCAATCTTCCTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-1468s1c1
Sequence:CCGGCTGTGGACACAGAGAATGATTCTCGAGAATCATTCTCTGTGTCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-857s1c1
Sequence:CCGGGCTTGGCTACAGCAGCGCCTTCTCGAGAAGGCGCTGCTGTAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080819
GPR78 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 78
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080819.2-1140s21c1
Sequence:CCGGAGGAAGATTGGCATTGCTATTCTCGAGAATAGCAATGCCAATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080819.2-1469s21c1
Sequence:CCGGTGTGGACACAGAGAATGATTCCTCGAGGAATCATTCTCTGTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080819.2-1618s1c1
Sequence:CCGGCTTTGAGCTAAGGCTGAAGTACTCGAGTACTTCAGCCTTAGCTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-1161s1c1
Sequence:CCGGGCGACCTTCCTCATCTGCTTTCTCGAGAAAGCAGATGAGGAAGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-1134s1c1
Sequence:CCGGGCCACCAGGAAGATTGGCATTCTCGAGAATGCCAATCTTCCTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-1468s1c1
Sequence:CCGGCTGTGGACACAGAGAATGATTCTCGAGAATCATTCTCTGTGTCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-857s1c1
Sequence:CCGGGCTTGGCTACAGCAGCGCCTTCTCGAGAAGGCGCTGCTGTAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080819
GPR78 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 78
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080819.2-1140s21c1
Sequence:CCGGAGGAAGATTGGCATTGCTATTCTCGAGAATAGCAATGCCAATCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080819.2-1469s21c1
Sequence:CCGGTGTGGACACAGAGAATGATTCCTCGAGGAATCATTCTCTGTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080819.2-1618s1c1
Sequence:CCGGCTTTGAGCTAAGGCTGAAGTACTCGAGTACTTCAGCCTTAGCTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-1161s1c1
Sequence:CCGGGCGACCTTCCTCATCTGCTTTCTCGAGAAAGCAGATGAGGAAGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-1134s1c1
Sequence:CCGGGCCACCAGGAAGATTGGCATTCTCGAGAATGCCAATCTTCCTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-1468s1c1
Sequence:CCGGCTGTGGACACAGAGAATGATTCTCGAGAATCATTCTCTGTGTCCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080819.2-857s1c1
Sequence:CCGGGCTTGGCTACAGCAGCGCCTTCTCGAGAAGGCGCTGCTGTAGCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks