EMAIL THIS PAGE TO A FRIEND

GPR82

G protein-coupled receptor 82

63 Gene Product Result for
UniProtKB ID: Q96P67, Q5VT13
Gene ID:
Human(27197) Summary: The protein encoded by this gene is an orphan G protein-coupled receptor of unknown function. The encoded protein is a member of a family of proteins that contain seven transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. [provided by RefSeq, Sep 2011]
Mouse(319200) G protein-coupled receptor 82
Rat(100362441) G protein-coupled receptor 82
naked mole-rat(101697114) G protein-coupled receptor 82
sheep(101105390) G protein-coupled receptor 82
chicken(101669596) G protein-coupled receptor 82
cow(101904496) G protein-coupled receptor 82
dog(100683784) G protein-coupled receptor 82
chicken(101750076) G protein-coupled receptor 82
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080817 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080817 Rosetta Predictions human pricing
NM_175669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064330 predicted 775
2 SASI_Hs02_00362587 predicted 437
3 SASI_Hs01_00064332 predicted 574
4 SASI_Hs01_00064333 predicted 883
5 SASI_Hs02_00362588 predicted 793
6 SASI_Hs01_00064334 predicted 996
7 SASI_Hs01_00064335 predicted 718
8 SASI_Hs01_00064336 predicted 785
9 SASI_Hs01_00064337 predicted 441
10 SASI_Hs01_00064338 predicted 486
11 SASI_Hs01_00064331 predicted 1128
12 SASI_Hs01_00064339 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028960 predicted 918
2 SASI_Mm01_00028961 predicted 318
3 SASI_Mm01_00028962 predicted 928
4 SASI_Mm01_00028963 predicted 876
5 SASI_Mm01_00028964 predicted 306
6 SASI_Mm02_00346605 predicted 935
7 SASI_Mm01_00028967 predicted 483
8 SASI_Mm01_00028968 predicted 870
9 SASI_Mm01_00028969 predicted 533
10 SASI_Mm02_00346606 predicted 663
11 SASI_Mm01_00028965 predicted 288
12 SASI_Mm01_00028966 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175669
GPR82 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 82
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-984s1c1
Sequence:CCGGCCTCCATTACCGAGAAAGATTCTCGAGAATCTTTCTCGGTAATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-312s1c1
Sequence:CCGGCCGTGATTTCTACCACAGCTTCTCGAGAAGCTGTGGTAGAAATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-479s1c1
Sequence:CCGGGCTATGCCTTTCATGGGTATACTCGAGTATACCCATGAAAGGCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-1236s1c1
Sequence:CCGGAGACACTATATGGTCTCCTTACTCGAGTAAGGAGACCATATAGTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-628s1c1
Sequence:CCGGCCGCTATGCTACCTTAATGAACTCGAGTTCATTAAGGTAGCATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175669.3-826s21c1
Sequence:CCGGGACAGAGCCAGTGCTACAATCCTCGAGGATTGTAGCACTGGCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175669.3-926s21c1
Sequence:CCGGAGTAGTGACATCATACTATTCCTCGAGGAATAGTATGATGTCACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175669.3-1412s21c1
Sequence:CCGGGACTTACAGTTCTACTTATATCTCGAGATATAAGTAGAACTGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175669
GPR82 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 82
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-984s1c1
Sequence:CCGGCCTCCATTACCGAGAAAGATTCTCGAGAATCTTTCTCGGTAATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-312s1c1
Sequence:CCGGCCGTGATTTCTACCACAGCTTCTCGAGAAGCTGTGGTAGAAATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-479s1c1
Sequence:CCGGGCTATGCCTTTCATGGGTATACTCGAGTATACCCATGAAAGGCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-1236s1c1
Sequence:CCGGAGACACTATATGGTCTCCTTACTCGAGTAAGGAGACCATATAGTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-628s1c1
Sequence:CCGGCCGCTATGCTACCTTAATGAACTCGAGTTCATTAAGGTAGCATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175669.3-826s21c1
Sequence:CCGGGACAGAGCCAGTGCTACAATCCTCGAGGATTGTAGCACTGGCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175669.3-926s21c1
Sequence:CCGGAGTAGTGACATCATACTATTCCTCGAGGAATAGTATGATGTCACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175669.3-1412s21c1
Sequence:CCGGGACTTACAGTTCTACTTATATCTCGAGATATAAGTAGAACTGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175669
GPR82 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 82
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-984s1c1
Sequence:CCGGCCTCCATTACCGAGAAAGATTCTCGAGAATCTTTCTCGGTAATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-312s1c1
Sequence:CCGGCCGTGATTTCTACCACAGCTTCTCGAGAAGCTGTGGTAGAAATCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-479s1c1
Sequence:CCGGGCTATGCCTTTCATGGGTATACTCGAGTATACCCATGAAAGGCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-1236s1c1
Sequence:CCGGAGACACTATATGGTCTCCTTACTCGAGTAAGGAGACCATATAGTGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175669.2-628s1c1
Sequence:CCGGCCGCTATGCTACCTTAATGAACTCGAGTTCATTAAGGTAGCATAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175669.3-826s21c1
Sequence:CCGGGACAGAGCCAGTGCTACAATCCTCGAGGATTGTAGCACTGGCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175669.3-926s21c1
Sequence:CCGGAGTAGTGACATCATACTATTCCTCGAGGAATAGTATGATGTCACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175669.3-1412s21c1
Sequence:CCGGGACTTACAGTTCTACTTATATCTCGAGATATAAGTAGAACTGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080817
GPR82 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 82
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-441s1c1
Sequence:CCGGCCAGCCCAACTTTGCTAGAAACTCGAGTTTCTAGCAAAGTTGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-55s1c1
Sequence:CCGGCCAATCATTTACATCCTCCTTCTCGAGAAGGAGGATGTAAATGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-555s1c1
Sequence:CCGGCCTATGCTACAATCGGCAGATCTCGAGATCTGCCGATTGTAGCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-377s1c1
Sequence:CCGGCCTCGCAAGAGACTACTTCATCTCGAGATGAAGTAGTCTCTTGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-782s1c1
Sequence:CCGGGCTTCCTTCCTTATAGTATTTCTCGAGAAATACTATAAGGAAGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-284s21c1
Sequence:CCGGCCATGGCTTTACCAATCATTTCTCGAGAAATGATTGGTAAAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-996s21c1
Sequence:CCGGGGTCATCCAGATTCTACTAATCTCGAGATTAGTAGAATCTGGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-498s21c1
Sequence:CCGGTCAATGCAGAGTGGTCAATTTCTCGAGAAATTGACCACTCTGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-1184s21c1
Sequence:CCGGCATTCAAGAAGACACTATATACTCGAGTATATAGTGTCTTCTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080817
GPR82 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 82
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-441s1c1
Sequence:CCGGCCAGCCCAACTTTGCTAGAAACTCGAGTTTCTAGCAAAGTTGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-55s1c1
Sequence:CCGGCCAATCATTTACATCCTCCTTCTCGAGAAGGAGGATGTAAATGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-555s1c1
Sequence:CCGGCCTATGCTACAATCGGCAGATCTCGAGATCTGCCGATTGTAGCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-377s1c1
Sequence:CCGGCCTCGCAAGAGACTACTTCATCTCGAGATGAAGTAGTCTCTTGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-782s1c1
Sequence:CCGGGCTTCCTTCCTTATAGTATTTCTCGAGAAATACTATAAGGAAGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-284s21c1
Sequence:CCGGCCATGGCTTTACCAATCATTTCTCGAGAAATGATTGGTAAAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-996s21c1
Sequence:CCGGGGTCATCCAGATTCTACTAATCTCGAGATTAGTAGAATCTGGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-498s21c1
Sequence:CCGGTCAATGCAGAGTGGTCAATTTCTCGAGAAATTGACCACTCTGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-1184s21c1
Sequence:CCGGCATTCAAGAAGACACTATATACTCGAGTATATAGTGTCTTCTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080817
GPR82 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 82
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-441s1c1
Sequence:CCGGCCAGCCCAACTTTGCTAGAAACTCGAGTTTCTAGCAAAGTTGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-55s1c1
Sequence:CCGGCCAATCATTTACATCCTCCTTCTCGAGAAGGAGGATGTAAATGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-555s1c1
Sequence:CCGGCCTATGCTACAATCGGCAGATCTCGAGATCTGCCGATTGTAGCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-377s1c1
Sequence:CCGGCCTCGCAAGAGACTACTTCATCTCGAGATGAAGTAGTCTCTTGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080817.1-782s1c1
Sequence:CCGGGCTTCCTTCCTTATAGTATTTCTCGAGAAATACTATAAGGAAGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-284s21c1
Sequence:CCGGCCATGGCTTTACCAATCATTTCTCGAGAAATGATTGGTAAAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-996s21c1
Sequence:CCGGGGTCATCCAGATTCTACTAATCTCGAGATTAGTAGAATCTGGATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-498s21c1
Sequence:CCGGTCAATGCAGAGTGGTCAATTTCTCGAGAAATTGACCACTCTGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080817.3-1184s21c1
Sequence:CCGGCATTCAAGAAGACACTATATACTCGAGTATATAGTGTCTTCTTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks