EMAIL THIS PAGE TO A FRIEND

GPR83

G protein-coupled receptor 83

115 Gene Product Result for
Synonyms: GIR GPR72
UniProtKB ID: Q9NYM4, B0M0K5, Q6NWR4, Q9P1Y8
Gene ID:
Mouse(14608) G protein-coupled receptor 83
Rat(140595) G protein-coupled receptor 83
chicken(428093) G protein-coupled receptor 83
cow(541301) G protein-coupled receptor 83
cow(525093) G protein-coupled receptor 83
Horse(100060898) G protein-coupled receptor 83
domestic cat(101087170) G protein-coupled receptor 83
dog(403699) G protein-coupled receptor 83
sheep(101118815) G protein-coupled receptor 83
Domestic Rabbit(100357881) G protein-coupled receptor 83
domestic guinea pig(100715788) G protein-coupled receptor 83
naked mole-rat(101708829) G protein-coupled receptor 83
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010287 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010287 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010287 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016540 Rosetta Predictions human pricing
NM_080411 Rosetta Predictions rat pricing
NM_010287 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084579 predicted 1326
2 SASI_Hs01_00084580 predicted 964
3 SASI_Hs01_00084581 predicted 652
4 SASI_Hs01_00084582 predicted 1056
5 SASI_Hs01_00084583 predicted 377
6 SASI_Hs01_00084584 predicted 613
7 SASI_Hs01_00084585 predicted 556
8 SASI_Hs01_00084586 predicted 636
9 SASI_Hs01_00084587 predicted 873
10 SASI_Hs01_00084588 predicted 1359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105207 predicted 1315
2 SASI_Rn01_00105208 predicted 422
3 SASI_Rn01_00105210 predicted 955
4 SASI_Rn01_00105211 predicted 580
5 SASI_Rn01_00105212 predicted 423
6 SASI_Rn01_00105213 predicted 1265
7 SASI_Rn01_00105214 predicted 542
8 SASI_Rn01_00105215 predicted 936
9 SASI_Rn01_00105216 predicted 435
10 SASI_Rn02_00267232 predicted 929
11 SASI_Rn01_00105209 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010287 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175159 predicted 738
2 SASI_Mm01_00175160 predicted 1238
3 SASI_Mm01_00175161 predicted 923
4 SASI_Mm01_00175162 predicted 1023
5 SASI_Mm02_00318247 predicted 1568
6 SASI_Mm01_00175163 predicted 1326
7 SASI_Mm01_00175164 predicted 405
8 SASI_Mm01_00175165 predicted 1016
9 SASI_Mm02_00318248 predicted 394
10 SASI_Mm01_00175166 predicted 1347
11 SASI_Mm01_00175167 predicted 921
12 SASI_Mm01_00175168 predicted 713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016540
GPR83 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 83
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016540.3-1175s21c1
Sequence:CCGGATGAGCAGCACCTGCTATAACCTCGAGGTTATAGCAGGTGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016540.3-507s21c1
Sequence:CCGGACCTGGCAGTTGCCGACATAACTCGAGTTATGTCGGCAACTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016540.3-570s21c1
Sequence:CCGGTGAACAGCACATGGATATTTGCTCGAGCAAATATCCATGTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016540.3-1801s21c1
Sequence:CCGGATCCCTAAGGGAGACCTAAATCTCGAGATTTAGGTCTCCCTTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016540.2-2291s1c1
Sequence:CCGGCCTCCCAAAGTGTTGGGATTACTCGAGTAATCCCAACACTTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-793s1c1
Sequence:CCGGCCAAGAAACTGTGGCTGTGTACTCGAGTACACAGCCACAGTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-125s1c1
Sequence:CCGGCTTCTTCTCTTGGAACAACTACTCGAGTAGTTGTTCCAAGAGAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-1031s1c1
Sequence:CCGGCTTCATATACTGCTGGCTGAACTCGAGTTCAGCCAGCAGTATATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-612s1c1
Sequence:CCGGCCACATGCTATCTGCCAGAAACTCGAGTTTCTGGCAGATAGCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016540
GPR83 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 83
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016540.3-1175s21c1
Sequence:CCGGATGAGCAGCACCTGCTATAACCTCGAGGTTATAGCAGGTGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016540.3-507s21c1
Sequence:CCGGACCTGGCAGTTGCCGACATAACTCGAGTTATGTCGGCAACTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016540.3-570s21c1
Sequence:CCGGTGAACAGCACATGGATATTTGCTCGAGCAAATATCCATGTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016540.3-1801s21c1
Sequence:CCGGATCCCTAAGGGAGACCTAAATCTCGAGATTTAGGTCTCCCTTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016540.2-2291s1c1
Sequence:CCGGCCTCCCAAAGTGTTGGGATTACTCGAGTAATCCCAACACTTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-793s1c1
Sequence:CCGGCCAAGAAACTGTGGCTGTGTACTCGAGTACACAGCCACAGTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-125s1c1
Sequence:CCGGCTTCTTCTCTTGGAACAACTACTCGAGTAGTTGTTCCAAGAGAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-1031s1c1
Sequence:CCGGCTTCATATACTGCTGGCTGAACTCGAGTTCAGCCAGCAGTATATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-612s1c1
Sequence:CCGGCCACATGCTATCTGCCAGAAACTCGAGTTTCTGGCAGATAGCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016540
GPR83 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 83
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016540.3-1175s21c1
Sequence:CCGGATGAGCAGCACCTGCTATAACCTCGAGGTTATAGCAGGTGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016540.3-507s21c1
Sequence:CCGGACCTGGCAGTTGCCGACATAACTCGAGTTATGTCGGCAACTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016540.3-570s21c1
Sequence:CCGGTGAACAGCACATGGATATTTGCTCGAGCAAATATCCATGTGCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016540.3-1801s21c1
Sequence:CCGGATCCCTAAGGGAGACCTAAATCTCGAGATTTAGGTCTCCCTTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016540.2-2291s1c1
Sequence:CCGGCCTCCCAAAGTGTTGGGATTACTCGAGTAATCCCAACACTTTGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-793s1c1
Sequence:CCGGCCAAGAAACTGTGGCTGTGTACTCGAGTACACAGCCACAGTTTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-125s1c1
Sequence:CCGGCTTCTTCTCTTGGAACAACTACTCGAGTAGTTGTTCCAAGAGAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-1031s1c1
Sequence:CCGGCTTCATATACTGCTGGCTGAACTCGAGTTCAGCCAGCAGTATATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016540.2-612s1c1
Sequence:CCGGCCACATGCTATCTGCCAGAAACTCGAGTTTCTGGCAGATAGCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010287
GPR83 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 83
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000026849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-657s1c1
Sequence:CCGGCCCTTCACTTTGGTCCGCTTTCTCGAGAAAGCGGACCAAAGTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-826s1c1
Sequence:CCGGCCATCACCAAGGGTGTCATATCTCGAGATATGACACCCTTGGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-512s1c1
Sequence:CCGGCTACTCATTCACCATCGTCTTCTCGAGAAGACGATGGTGAATGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-1282s1c1
Sequence:CCGGCCATGAGCAGTACTTGTTATACTCGAGTATAACAAGTACTGCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010287
GPR83 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 83
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000026849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-657s1c1
Sequence:CCGGCCCTTCACTTTGGTCCGCTTTCTCGAGAAAGCGGACCAAAGTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-826s1c1
Sequence:CCGGCCATCACCAAGGGTGTCATATCTCGAGATATGACACCCTTGGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-512s1c1
Sequence:CCGGCTACTCATTCACCATCGTCTTCTCGAGAAGACGATGGTGAATGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-1282s1c1
Sequence:CCGGCCATGAGCAGTACTTGTTATACTCGAGTATAACAAGTACTGCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010287
GPR83 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 83
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000026849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-657s1c1
Sequence:CCGGCCCTTCACTTTGGTCCGCTTTCTCGAGAAAGCGGACCAAAGTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-826s1c1
Sequence:CCGGCCATCACCAAGGGTGTCATATCTCGAGATATGACACCCTTGGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-512s1c1
Sequence:CCGGCTACTCATTCACCATCGTCTTCTCGAGAAGACGATGGTGAATGAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010287.1-1282s1c1
Sequence:CCGGCCATGAGCAGTACTTGTTATACTCGAGTATAACAAGTACTGCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks