EMAIL THIS PAGE TO A FRIEND

GPR85

G protein-coupled receptor 85

214 Gene Product Result for
Synonyms: SREB SREB2
UniProtKB ID: P60893, Q9JHI6, Q9NPD1
Gene ID:
Human(54329) Summary: Members of the G protein-coupled receptor (GPCR) family, such as GPR85, have a similar structure characterized by 7 transmembrane domains. Activation of GPCRs by extracellular stimuli, such as neurotransmitters, hormones, or light, induces an intracellular signaling cascade mediated by heterotrimeric GTP-binding proteins, or G proteins (Matsumoto et al., 2000 [PubMed 10833454]
Mouse(64450) G protein-coupled receptor 85
Rat(64020) G protein-coupled receptor 85
sheep(101111360) G protein-coupled receptor 85
domestic guinea pig(100716752) G protein-coupled receptor 85
naked mole-rat(101700522) G protein-coupled receptor 85
Zebrafish(793299) G protein-coupled receptor 85
domestic cat(101084349) G protein-coupled receptor 85
Horse(100055809) G protein-coupled receptor 85
cow(504208) G protein-coupled receptor 85
dog(482410) G protein-coupled receptor 85
chicken(417775) G protein-coupled receptor 85
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502242 Anti-GPR85 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB2900550 Anti-GPR85 antibody produced in rabbit affinity isolated antibody mouse, zebrafish, human, Xenopus, chicken, rat
immunohistochemistry pricing
SAB2900551 Anti-GPR85 antibody produced in rabbit affinity isolated antibody bovine, rabbit, human, monkey, mouse, hamster, zebrafish, horse, Xenopus, chicken, pig, dog, rat
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018970 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018970 Rosetta Predictions human pricing
NM_022254 Rosetta Predictions rat pricing
NM_145066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146922 predicted 895
2 SASI_Hs01_00146923 predicted 664
3 SASI_Hs01_00146924 predicted 797
4 SASI_Hs01_00146925 predicted 822
5 SASI_Hs01_00146926 predicted 1711
6 SASI_Hs01_00146927 predicted 1216
7 SASI_Hs02_00352451 predicted 841
8 SASI_Hs02_00352452 predicted 939
9 SASI_Hs01_00146929 predicted 1345
10 SASI_Hs01_00146930 predicted 776
11 SASI_Hs01_00146928 predicted 1068
12 SASI_Hs01_00146931 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085275 predicted 401
2 SASI_Rn01_00085276 predicted 1106
3 SASI_Rn01_00085277 predicted 539
4 SASI_Rn01_00085278 predicted 798
5 SASI_Rn01_00085279 predicted 1103
6 SASI_Rn01_00085280 predicted 305
7 SASI_Rn01_00085281 predicted 1153
8 SASI_Rn01_00085282 predicted 864
9 SASI_Rn01_00085283 predicted 745
10 SASI_Rn01_00085284 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055743 predicted 1661
2 SASI_Mm01_00055744 predicted 1162
3 SASI_Mm01_00055746 predicted 2208
4 SASI_Mm01_00055747 predicted 1925
5 SASI_Mm01_00055748 predicted 1833
6 SASI_Mm01_00055749 predicted 1790
7 SASI_Mm01_00055750 predicted 2258
8 SASI_Mm01_00055751 predicted 1712
9 SASI_Mm01_00055752 predicted 2217
10 SASI_Mm02_00340490 predicted 2328
11 SASI_Mm01_00055745 predicted 1402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145066
VALIDATED
GPR85 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 85
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145066.4-1616s21c1
Sequence:CCGGCATTAGGGAGGAGGATCAATGCTCGAGCATTGATCCTCCTCCCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145066.4-2613s21c1
Sequence:CCGGTGAGGTAAATGTGTTGATAAACTCGAGTTTATCAACACATTTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145066.4-2429s21c1
Sequence:CCGGTGGCGAAGGTTTGTAATTAAGCTCGAGCTTAATTACAAACCTTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145066.4-2111s1c1
Sequence:CCGGCCAAGCAGGAATCAATCCCTTCTCGAGAAGGGATTGATTCCTGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145066.4-1231s1c1
Sequence:CCGGGCAACCTTCTGATCTCCATTTCTCGAGAAATGGAGATCAGAAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145066.4-1674s1c1
Sequence:CCGGCTAGGATTTATGCTGCTCCTTCTCGAGAAGGAGCAGCATAAATCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145066.4-2525s1c1
Sequence:CCGGCAGTGCTAAATGCTGTGTATACTCGAGTATACACAGCATTTAGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145066.4-1931s1c1
Sequence:CCGGGCTATTGGTCTTGGATGAGTTCTCGAGAACTCATCCAAGACCAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145066
VALIDATED
GPR85 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 85
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145066.4-1616s21c1
Sequence:CCGGCATTAGGGAGGAGGATCAATGCTCGAGCATTGATCCTCCTCCCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145066.4-2613s21c1
Sequence:CCGGTGAGGTAAATGTGTTGATAAACTCGAGTTTATCAACACATTTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145066.4-2429s21c1
Sequence:CCGGTGGCGAAGGTTTGTAATTAAGCTCGAGCTTAATTACAAACCTTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145066.4-2111s1c1
Sequence:CCGGCCAAGCAGGAATCAATCCCTTCTCGAGAAGGGATTGATTCCTGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145066.4-1231s1c1
Sequence:CCGGGCAACCTTCTGATCTCCATTTCTCGAGAAATGGAGATCAGAAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145066.4-1674s1c1
Sequence:CCGGCTAGGATTTATGCTGCTCCTTCTCGAGAAGGAGCAGCATAAATCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145066.4-2525s1c1
Sequence:CCGGCAGTGCTAAATGCTGTGTATACTCGAGTATACACAGCATTTAGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145066.4-1931s1c1
Sequence:CCGGGCTATTGGTCTTGGATGAGTTCTCGAGAACTCATCCAAGACCAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145066
VALIDATED
GPR85 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 85
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145066.4-1616s21c1
Sequence:CCGGCATTAGGGAGGAGGATCAATGCTCGAGCATTGATCCTCCTCCCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145066.4-2613s21c1
Sequence:CCGGTGAGGTAAATGTGTTGATAAACTCGAGTTTATCAACACATTTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145066.4-2429s21c1
Sequence:CCGGTGGCGAAGGTTTGTAATTAAGCTCGAGCTTAATTACAAACCTTCGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145066.4-2111s1c1
Sequence:CCGGCCAAGCAGGAATCAATCCCTTCTCGAGAAGGGATTGATTCCTGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145066.4-1231s1c1
Sequence:CCGGGCAACCTTCTGATCTCCATTTCTCGAGAAATGGAGATCAGAAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145066.4-1674s1c1
Sequence:CCGGCTAGGATTTATGCTGCTCCTTCTCGAGAAGGAGCAGCATAAATCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028321    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145066.4-2525s1c1
Sequence:CCGGCAGTGCTAAATGCTGTGTATACTCGAGTATACACAGCATTTAGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145066.4-1931s1c1
Sequence:CCGGGCTATTGGTCTTGGATGAGTTCTCGAGAACTCATCCAAGACCAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018970
GPR85 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 85
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018970.6-1225s21c1
Sequence:CCGGGTCTACCTCAAGCTGATATTTCTCGAGAAATATCAGCTTGAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018970.6-1792s21c1
Sequence:CCGGTTGTGGCCCATAGCCATATTTCTCGAGAAATATGGCTATGGGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018970.6-1099s21c1
Sequence:CCGGGACGTGGGCACTTACTCATTCCTCGAGGAATGAGTAAGTGCCCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018970.6-1874s21c1
Sequence:CCGGTTGCAATAGTTCACCTATAATCTCGAGATTATAGGTGAACTATTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018970.3-4226s1c1
Sequence:CCGGCCTCAGTGAATCAATGCCATTCTCGAGAATGGCATTGATTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-1056s1c1
Sequence:CCGGGTGGGCACTTACTCATTCATTCTCGAGAATGAATGAGTAAGTGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-766s1c1
Sequence:CCGGGCTGTTCAGATATCCTCAGATCTCGAGATCTGAGGATATCTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-644s1c1
Sequence:CCGGGAAACTGACTTCCTTGGGTTTCTCGAGAAACCCAAGGAAGTCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-1388s1c1
Sequence:CCGGGCTATTGGTCTTAGACGAGTTCTCGAGAACTCGTCTAAGACCAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018970
GPR85 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 85
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018970.6-1225s21c1
Sequence:CCGGGTCTACCTCAAGCTGATATTTCTCGAGAAATATCAGCTTGAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018970.6-1792s21c1
Sequence:CCGGTTGTGGCCCATAGCCATATTTCTCGAGAAATATGGCTATGGGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018970.6-1099s21c1
Sequence:CCGGGACGTGGGCACTTACTCATTCCTCGAGGAATGAGTAAGTGCCCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018970.6-1874s21c1
Sequence:CCGGTTGCAATAGTTCACCTATAATCTCGAGATTATAGGTGAACTATTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018970.3-4226s1c1
Sequence:CCGGCCTCAGTGAATCAATGCCATTCTCGAGAATGGCATTGATTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-1056s1c1
Sequence:CCGGGTGGGCACTTACTCATTCATTCTCGAGAATGAATGAGTAAGTGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-766s1c1
Sequence:CCGGGCTGTTCAGATATCCTCAGATCTCGAGATCTGAGGATATCTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-644s1c1
Sequence:CCGGGAAACTGACTTCCTTGGGTTTCTCGAGAAACCCAAGGAAGTCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-1388s1c1
Sequence:CCGGGCTATTGGTCTTAGACGAGTTCTCGAGAACTCGTCTAAGACCAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018970
GPR85 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 85
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018970.6-1225s21c1
Sequence:CCGGGTCTACCTCAAGCTGATATTTCTCGAGAAATATCAGCTTGAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367774    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018970.6-1792s21c1
Sequence:CCGGTTGTGGCCCATAGCCATATTTCTCGAGAAATATGGCTATGGGCCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018970.6-1099s21c1
Sequence:CCGGGACGTGGGCACTTACTCATTCCTCGAGGAATGAGTAAGTGCCCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018970.6-1874s21c1
Sequence:CCGGTTGCAATAGTTCACCTATAATCTCGAGATTATAGGTGAACTATTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018970.3-4226s1c1
Sequence:CCGGCCTCAGTGAATCAATGCCATTCTCGAGAATGGCATTGATTCACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-1056s1c1
Sequence:CCGGGTGGGCACTTACTCATTCATTCTCGAGAATGAATGAGTAAGTGCCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-766s1c1
Sequence:CCGGGCTGTTCAGATATCCTCAGATCTCGAGATCTGAGGATATCTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-644s1c1
Sequence:CCGGGAAACTGACTTCCTTGGGTTTCTCGAGAAACCCAAGGAAGTCAGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018970.3-1388s1c1
Sequence:CCGGGCTATTGGTCTTAGACGAGTTCTCGAGAACTCGTCTAAGACCAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks