EMAIL THIS PAGE TO A FRIEND

GPR87

G protein-coupled receptor 87

55 Gene Product Result for
Synonyms: GPR95 KPG_002
UniProtKB ID: Q9BY21, Q5KU35, Q96JZ8, Q9BXC2
Gene ID:
Human(53836) Summary: This gene encodes a G protein-coupled receptor and is located in a cluster of G protein-couple receptor genes on chromosome 3. The encoded protein has been shown to be overexpressed in lung squamous cell carcinoma (PMID:18057535) and regulated by p53 (PMID:19602589). [provided by RefSeq, Nov 2011]
Mouse(84111) G protein-coupled receptor 87
Rat(310443) G protein-coupled receptor 87
chicken(425038) G protein-coupled receptor 87
cow(785030) G protein-coupled receptor 87
Horse(100050286) G protein-coupled receptor 87
domestic cat(101092881) G protein-coupled receptor 87
dog(485718) G protein-coupled receptor 87
sheep(101117208) G protein-coupled receptor 87
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023915 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027191 MISSION® esiRNA esiRNA human GPR87 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023915 Rosetta Predictions human pricing
NM_001107677 Rosetta Predictions rat pricing
NM_032399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218913 predicted 527
2 SASI_Hs01_00218914 predicted 755
3 SASI_Hs01_00218915 predicted 806
4 SASI_Hs01_00218916 predicted 919
5 SASI_Hs01_00218918 predicted 661
6 SASI_Hs01_00218919 predicted 620
7 SASI_Hs02_00356364 predicted 1151
8 SASI_Hs01_00218920 predicted 893
9 SASI_Hs02_00356365 predicted 1151
10 SASI_Hs02_00356366 predicted 888
11 SASI_Hs01_00218912 predicted 683
12 SASI_Hs01_00218917 predicted 845
13 SASI_Hs01_00218921 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231185 predicted 268
2 SASI_Rn02_00231186 predicted 534
3 SASI_Rn02_00231187 predicted 604
4 SASI_Rn02_00231188 predicted 850
5 SASI_Rn02_00231189 predicted 481
6 SASI_Rn02_00231190 predicted 445
7 SASI_Rn02_00231191 predicted 394
8 SASI_Rn02_00231192 predicted 415
9 SASI_Rn02_00231193 predicted 521
10 SASI_Rn02_00231194 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142069 predicted 605
2 SASI_Mm01_00142070 predicted 534
3 SASI_Mm01_00142071 predicted 278
4 SASI_Mm01_00142072 predicted 463
5 SASI_Mm01_00142073 predicted 507
6 SASI_Mm01_00142075 predicted 401
7 SASI_Mm01_00142076 predicted 875
8 SASI_Mm01_00142077 predicted 616
9 SASI_Mm02_00337244 predicted 800
10 SASI_Mm01_00142078 predicted 524
11 SASI_Mm01_00142074 predicted 406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032399
VALIDATED
GPR87 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 87
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-286s1c1
Sequence:CCGGCCATTCCGAATAGTCCGTGATCTCGAGATCACGGACTATTCGGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-801s1c1
Sequence:CCGGCCCGTATCACTTGTGCAGAATCTCGAGATTCTGCACAAGTGATACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-192s1c1
Sequence:CCGGCGTGTGGATCTTCTTCCACATCTCGAGATGTGGAAGAAGATCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-138s1c1
Sequence:CCGGGCCAGTGCTTTACCTAGTTATCTCGAGATAACTAGGTAAAGCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032399.1-876s1c1
Sequence:CCGGCCTCTACTATTGCAAAGAAATCTCGAGATTTCTTTGCAATAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-192s21c1
Sequence:CCGGCGTGTGGATCTTCTTCCACATCTCGAGATGTGGAAGAAGATCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-801s21c1
Sequence:CCGGCCCGTATCACTTGTGCAGAATCTCGAGATTCTGCACAAGTGATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-317s21c1
Sequence:CCGGGACCTTGGTACTTCGAGTTTACTCGAGTAAACTCGAAGTACCAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-922s21c1
Sequence:CCGGGTGTGCCTGGATCCGATAATTCTCGAGAATTATCGGATCCAGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-138s21c1
Sequence:CCGGGCCAGTGCTTTACCTAGTTATCTCGAGATAACTAGGTAAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032399
VALIDATED
GPR87 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 87
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-286s1c1
Sequence:CCGGCCATTCCGAATAGTCCGTGATCTCGAGATCACGGACTATTCGGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-801s1c1
Sequence:CCGGCCCGTATCACTTGTGCAGAATCTCGAGATTCTGCACAAGTGATACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-192s1c1
Sequence:CCGGCGTGTGGATCTTCTTCCACATCTCGAGATGTGGAAGAAGATCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-138s1c1
Sequence:CCGGGCCAGTGCTTTACCTAGTTATCTCGAGATAACTAGGTAAAGCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032399.1-876s1c1
Sequence:CCGGCCTCTACTATTGCAAAGAAATCTCGAGATTTCTTTGCAATAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-192s21c1
Sequence:CCGGCGTGTGGATCTTCTTCCACATCTCGAGATGTGGAAGAAGATCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-801s21c1
Sequence:CCGGCCCGTATCACTTGTGCAGAATCTCGAGATTCTGCACAAGTGATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-317s21c1
Sequence:CCGGGACCTTGGTACTTCGAGTTTACTCGAGTAAACTCGAAGTACCAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-922s21c1
Sequence:CCGGGTGTGCCTGGATCCGATAATTCTCGAGAATTATCGGATCCAGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-138s21c1
Sequence:CCGGGCCAGTGCTTTACCTAGTTATCTCGAGATAACTAGGTAAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032399
VALIDATED
GPR87 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 87
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-286s1c1
Sequence:CCGGCCATTCCGAATAGTCCGTGATCTCGAGATCACGGACTATTCGGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-801s1c1
Sequence:CCGGCCCGTATCACTTGTGCAGAATCTCGAGATTCTGCACAAGTGATACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-192s1c1
Sequence:CCGGCGTGTGGATCTTCTTCCACATCTCGAGATGTGGAAGAAGATCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032399.1-138s1c1
Sequence:CCGGGCCAGTGCTTTACCTAGTTATCTCGAGATAACTAGGTAAAGCACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032399.1-876s1c1
Sequence:CCGGCCTCTACTATTGCAAAGAAATCTCGAGATTTCTTTGCAATAGTAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-192s21c1
Sequence:CCGGCGTGTGGATCTTCTTCCACATCTCGAGATGTGGAAGAAGATCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-801s21c1
Sequence:CCGGCCCGTATCACTTGTGCAGAATCTCGAGATTCTGCACAAGTGATACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-317s21c1
Sequence:CCGGGACCTTGGTACTTCGAGTTTACTCGAGTAAACTCGAAGTACCAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-922s21c1
Sequence:CCGGGTGTGCCTGGATCCGATAATTCTCGAGAATTATCGGATCCAGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032399.1-138s21c1
Sequence:CCGGGCCAGTGCTTTACCTAGTTATCTCGAGATAACTAGGTAAAGCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023915
GPR87 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 87
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-677s1c1
Sequence:CCGGCCTTGGTACTTCAAGTTTATTCTCGAGAATAAACTTGAAGTACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-497s1c1
Sequence:CCGGCCGGTGCTTTATCTCATTATACTCGAGTATAATGAGATAAAGCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-883s1c1
Sequence:CCGGGCCAAACATCATCCTGACAAACTCGAGTTTGTCAGGATGATGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-622s1c1
Sequence:CCGGCCTCATAATGACGCTGACATTCTCGAGAATGTCAGCGTCATTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-1271s1c1
Sequence:CCGGGCGTGTAATGTTTGCCTGGATCTCGAGATCCAGGCAAACATTACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023915.3-884s21c1
Sequence:CCGGCCAAACATCATCCTAACAAATCTCGAGATTTGTTAGGATGATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023915.3-1029s21c1
Sequence:CCGGTCGGATGTTACATAGCCATATCTCGAGATATGGCTATGTAACATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023915.3-1146s21c1
Sequence:CCGGTTACCTGCTTTCTACCATATCCTCGAGGATATGGTAGAAAGCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023915
GPR87 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 87
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-677s1c1
Sequence:CCGGCCTTGGTACTTCAAGTTTATTCTCGAGAATAAACTTGAAGTACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-497s1c1
Sequence:CCGGCCGGTGCTTTATCTCATTATACTCGAGTATAATGAGATAAAGCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-883s1c1
Sequence:CCGGGCCAAACATCATCCTGACAAACTCGAGTTTGTCAGGATGATGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-622s1c1
Sequence:CCGGCCTCATAATGACGCTGACATTCTCGAGAATGTCAGCGTCATTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-1271s1c1
Sequence:CCGGGCGTGTAATGTTTGCCTGGATCTCGAGATCCAGGCAAACATTACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023915.3-884s21c1
Sequence:CCGGCCAAACATCATCCTAACAAATCTCGAGATTTGTTAGGATGATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023915.3-1029s21c1
Sequence:CCGGTCGGATGTTACATAGCCATATCTCGAGATATGGCTATGTAACATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023915.3-1146s21c1
Sequence:CCGGTTACCTGCTTTCTACCATATCCTCGAGGATATGGTAGAAAGCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023915
GPR87 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 87
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-677s1c1
Sequence:CCGGCCTTGGTACTTCAAGTTTATTCTCGAGAATAAACTTGAAGTACCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-497s1c1
Sequence:CCGGCCGGTGCTTTATCTCATTATACTCGAGTATAATGAGATAAAGCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-883s1c1
Sequence:CCGGGCCAAACATCATCCTGACAAACTCGAGTTTGTCAGGATGATGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-622s1c1
Sequence:CCGGCCTCATAATGACGCTGACATTCTCGAGAATGTCAGCGTCATTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023915.2-1271s1c1
Sequence:CCGGGCGTGTAATGTTTGCCTGGATCTCGAGATCCAGGCAAACATTACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023915.3-884s21c1
Sequence:CCGGCCAAACATCATCCTAACAAATCTCGAGATTTGTTAGGATGATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023915.3-1029s21c1
Sequence:CCGGTCGGATGTTACATAGCCATATCTCGAGATATGGCTATGTAACATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023915.3-1146s21c1
Sequence:CCGGTTACCTGCTTTCTACCATATCCTCGAGGATATGGTAGAAAGCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks