EMAIL THIS PAGE TO A FRIEND

GPR88

G protein-coupled receptor 88

Synonyms: STRG
UniProtKB ID: Q9GZN0, Q29S24, Q6VN48
Gene ID:
Mouse(64378) G-protein coupled receptor 88
Rat(64443) G-protein coupled receptor 88
sheep(101121739) G protein-coupled receptor 88
domestic guinea pig(100732064) G protein-coupled receptor 88
naked mole-rat(101724894) G protein-coupled receptor 88
Zebrafish(100002845) G protein-coupled receptor 88
cow(781302) G protein-coupled receptor 88
domestic cat(101090126) G protein-coupled receptor 88
dog(100686636) G protein-coupled receptor 88
chicken(769393) G protein-coupled receptor 88
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022049 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051901 MISSION® esiRNA esiRNA human GPR88 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022049 Rosetta Predictions human pricing
NM_031696 Rosetta Predictions rat pricing
NM_022427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139683 predicted 559
2 SASI_Hs01_00139679 predicted 1823
3 SASI_Hs01_00139686 predicted 1921
4 SASI_Hs02_00355402 predicted 1714
5 SASI_Hs02_00355403 predicted 590
6 SASI_Hs01_00139687 predicted 854
7 SASI_Hs02_00355404 predicted 845
8 SASI_Hs02_00355405 predicted 770
9 SASI_Hs02_00355406 predicted 1593
10 SASI_Hs02_00355407 predicted 834
11 SASI_Hs01_00139680 predicted 1936
12 SASI_Hs01_00139681 predicted 2003
13 SASI_Hs01_00139682 predicted 1899
14 SASI_Hs01_00139684 predicted 2066
15 SASI_Hs01_00139685 predicted 633
16 SASI_Hs01_00139688 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077435 predicted 590
2 SASI_Rn01_00077436 predicted 1477
3 SASI_Rn01_00077437 predicted 1587
4 SASI_Rn01_00077438 predicted 835
5 SASI_Rn02_00265050 predicted 632
6 SASI_Rn02_00265051 predicted 1756
7 SASI_Rn01_00077441 predicted 604
8 SASI_Rn01_00077442 predicted 879
9 SASI_Rn01_00077443 predicted 1715
10 SASI_Rn01_00077444 predicted 883
11 SASI_Rn01_00077439 predicted 1760
12 SASI_Rn01_00077440 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065589 predicted 2041
2 SASI_Mm01_00065590 predicted 1820
3 SASI_Mm02_00326597 predicted 1820
4 SASI_Mm01_00065591 predicted 1765
5 SASI_Mm01_00065592 predicted 1821
6 SASI_Mm01_00065593 predicted 579
7 SASI_Mm01_00065594 predicted 598
8 SASI_Mm02_00326598 predicted 1814
9 SASI_Mm01_00065595 predicted 2088
10 SASI_Mm01_00065597 predicted 880
11 SASI_Mm01_00065588 predicted 1642
12 SASI_Mm01_00065596 predicted 1895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022427
GPR88 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 88
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022427.2-1927s21c1
Sequence:CCGGTTCCAACCTCCACCGTCTTATCTCGAGATAAGACGGTGGAGGTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022427.2-1591s21c1
Sequence:CCAGACTGGTAACACACCTTGCTTGCTCGAGCAAGCAAGGTGTGTTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022427.2-1759s21c1
Sequence:CCGGTGTGCGGCCATTGACGTTTACCTCGAGGTAAACGTCAATGGCCGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022427.1-1515s1c1
Sequence:CCGGCCAGCCATGTCCCAGGCGCAACTCGAGTTGCGCCTGGGACATGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022427.1-555s1c1
Sequence:CCGGGCCAACGGTATGGTCATCTATCTCGAGATAGATGACCATACCGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022427.1-3139s1c1
Sequence:CCGGGCCTCAATTAACTGTGTAATTCTCGAGAATTACACAGTTAATTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022427.1-609s1c1
Sequence:CCGGAGCAACGCCTTCATCGTGAATCTCGAGATTCACGATGAAGGCGTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022427
GPR88 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 88
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022427.2-1927s21c1
Sequence:CCGGTTCCAACCTCCACCGTCTTATCTCGAGATAAGACGGTGGAGGTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022427.2-1591s21c1
Sequence:CCAGACTGGTAACACACCTTGCTTGCTCGAGCAAGCAAGGTGTGTTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022427.2-1759s21c1
Sequence:CCGGTGTGCGGCCATTGACGTTTACCTCGAGGTAAACGTCAATGGCCGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022427.1-1515s1c1
Sequence:CCGGCCAGCCATGTCCCAGGCGCAACTCGAGTTGCGCCTGGGACATGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022427.1-555s1c1
Sequence:CCGGGCCAACGGTATGGTCATCTATCTCGAGATAGATGACCATACCGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022427.1-3139s1c1
Sequence:CCGGGCCTCAATTAACTGTGTAATTCTCGAGAATTACACAGTTAATTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022427.1-609s1c1
Sequence:CCGGAGCAACGCCTTCATCGTGAATCTCGAGATTCACGATGAAGGCGTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022427
GPR88 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 88
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022427.2-1927s21c1
Sequence:CCGGTTCCAACCTCCACCGTCTTATCTCGAGATAAGACGGTGGAGGTTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022427.2-1591s21c1
Sequence:CCAGACTGGTAACACACCTTGCTTGCTCGAGCAAGCAAGGTGTGTTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022427.2-1759s21c1
Sequence:CCGGTGTGCGGCCATTGACGTTTACCTCGAGGTAAACGTCAATGGCCGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022427.1-1515s1c1
Sequence:CCGGCCAGCCATGTCCCAGGCGCAACTCGAGTTGCGCCTGGGACATGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022427.1-555s1c1
Sequence:CCGGGCCAACGGTATGGTCATCTATCTCGAGATAGATGACCATACCGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022427.1-3139s1c1
Sequence:CCGGGCCTCAATTAACTGTGTAATTCTCGAGAATTACACAGTTAATTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022427.1-609s1c1
Sequence:CCGGAGCAACGCCTTCATCGTGAATCTCGAGATTCACGATGAAGGCGTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022049
GPR88 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 88
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022049.2-1926s21c1
Sequence:CCGGTTTCCACTTTCATCGTCTTATCTCGAGATAAGACGATGAAAGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022049.2-2043s21c1
Sequence:CCGGTGATGCTTCTCTTACCATTTACTCGAGTAAATGGTAAGAGAAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022049.2-547s21c1
Sequence:CCGGCCAACGGCATGGTCATCTATCCTCGAGGATAGATGACCATGCCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022049.2-499s21c1
Sequence:CCGGTCCCGGTGTCACTCCTGTATTCTCGAGAATACAGGAGTGACACCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022049.1-2946s1c1
Sequence:CCGGCCACGACATTTAACATCAATACTCGAGTATTGATGTTAAATGTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022049.1-586s1c1
Sequence:CCGGGCATGGTCATCTATCTCGTGTCTCGAGACACGAGATAGATGACCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022049.1-1118s1c1
Sequence:CCGGCGTGCTCAACTTCCACCTGCTCTCGAGAGCAGGTGGAAGTTGAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022049.1-875s1c1
Sequence:CCGGCGCCACCTACCAGGCGCTGTACTCGAGTACAGCGCCTGGTAGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022049
GPR88 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 88
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022049.2-1926s21c1
Sequence:CCGGTTTCCACTTTCATCGTCTTATCTCGAGATAAGACGATGAAAGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022049.2-2043s21c1
Sequence:CCGGTGATGCTTCTCTTACCATTTACTCGAGTAAATGGTAAGAGAAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022049.2-547s21c1
Sequence:CCGGCCAACGGCATGGTCATCTATCCTCGAGGATAGATGACCATGCCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022049.2-499s21c1
Sequence:CCGGTCCCGGTGTCACTCCTGTATTCTCGAGAATACAGGAGTGACACCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022049.1-2946s1c1
Sequence:CCGGCCACGACATTTAACATCAATACTCGAGTATTGATGTTAAATGTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022049.1-586s1c1
Sequence:CCGGGCATGGTCATCTATCTCGTGTCTCGAGACACGAGATAGATGACCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022049.1-1118s1c1
Sequence:CCGGCGTGCTCAACTTCCACCTGCTCTCGAGAGCAGGTGGAAGTTGAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022049.1-875s1c1
Sequence:CCGGCGCCACCTACCAGGCGCTGTACTCGAGTACAGCGCCTGGTAGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022049
GPR88 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 88
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022049.2-1926s21c1
Sequence:CCGGTTTCCACTTTCATCGTCTTATCTCGAGATAAGACGATGAAAGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022049.2-2043s21c1
Sequence:CCGGTGATGCTTCTCTTACCATTTACTCGAGTAAATGGTAAGAGAAGCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022049.2-547s21c1
Sequence:CCGGCCAACGGCATGGTCATCTATCCTCGAGGATAGATGACCATGCCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022049.2-499s21c1
Sequence:CCGGTCCCGGTGTCACTCCTGTATTCTCGAGAATACAGGAGTGACACCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008971    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022049.1-2946s1c1
Sequence:CCGGCCACGACATTTAACATCAATACTCGAGTATTGATGTTAAATGTCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022049.1-586s1c1
Sequence:CCGGGCATGGTCATCTATCTCGTGTCTCGAGACACGAGATAGATGACCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022049.1-1118s1c1
Sequence:CCGGCGTGCTCAACTTCCACCTGCTCTCGAGAGCAGGTGGAAGTTGAGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022049.1-875s1c1
Sequence:CCGGCGCCACCTACCAGGCGCTGTACTCGAGTACAGCGCCTGGTAGGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks