EMAIL THIS PAGE TO A FRIEND

GPR89A

G protein-coupled receptor 89A

42 Gene Product Result for
Synonyms: GPR89B UNQ192
Gene ID:
Human(653519) Summary: GPR89A is a nearly identical copy of the GPR89B gene (MIM 612806).[supplied by OMIM, Jun 2009]
dog(483157) G protein-coupled receptor 89A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001097612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097612 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097612 Rosetta Predictions human pricing
NM_001097613 Rosetta Predictions human pricing
XM_927869 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318420 predicted 251
2 SASI_Hs02_00318421 predicted 983
3 SASI_Hs02_00318422 predicted 1324
4 SASI_Hs02_00318423 predicted 1496
5 SASI_Hs02_00318424 predicted 939
6 SASI_Hs02_00318425 predicted 1542
7 SASI_Hs02_00318426 predicted 1417
8 SASI_Hs02_00318427 predicted 1523
9 SASI_Hs02_00318428 predicted 1164
10 SASI_Hs02_00318429 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318430 predicted 1007
2 SASI_Hs02_00318431 predicted 1339
3 SASI_Hs02_00318432 predicted 1524
4 SASI_Hs02_00318433 predicted 954
5 SASI_Hs02_00318434 predicted 1569
6 SASI_Hs02_00318435 predicted 1434
7 SASI_Hs02_00318436 predicted 1539
8 SASI_Hs02_00318437 predicted 1157
9 SASI_Hs02_00318438 predicted 975
10 SASI_Hs02_00318439 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274578 predicted 471
2 SASI_Hs01_00274579 predicted 416
3 SASI_Hs01_00274580 predicted 358
4 SASI_Hs01_00274581 predicted 562
5 SASI_Hs01_00274582 predicted 382
6 SASI_Hs01_00274583 predicted 596
7 SASI_Hs01_00274584 predicted 590
8 SASI_Hs01_00274585 predicted 407
9 SASI_Hs01_00274586 predicted 676
10 SASI_Hs01_00274587 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097612
VALIDATED
GPR89A MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 89A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097612.1-269s21c1
Sequence:CCGGACTATGAGATACGTCAGTATGCTCGAGCATACTGACGTATCTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-1610s21c1
Sequence:CCGGTGGAACCAGGGCCTGACATTTCTCGAGAAATGTCAGGCCCTGGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-713s21c1
Sequence:CCGGATGTGACTGACACGGATATTCCTCGAGGAATATCCGTGTCAGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-372s21c1
Sequence:CCGGGAATAGCAGCTCCCGTTATTTCTCGAGAAATAACGGGAGCTGCTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-204s21c1
Sequence:CCGGGATTACCTCCCAGATACTATTCTCGAGAATAGTATCTGGGAGGTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097612
VALIDATED
GPR89A MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 89A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097612.1-269s21c1
Sequence:CCGGACTATGAGATACGTCAGTATGCTCGAGCATACTGACGTATCTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-1610s21c1
Sequence:CCGGTGGAACCAGGGCCTGACATTTCTCGAGAAATGTCAGGCCCTGGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-713s21c1
Sequence:CCGGATGTGACTGACACGGATATTCCTCGAGGAATATCCGTGTCAGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-372s21c1
Sequence:CCGGGAATAGCAGCTCCCGTTATTTCTCGAGAAATAACGGGAGCTGCTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-204s21c1
Sequence:CCGGGATTACCTCCCAGATACTATTCTCGAGAATAGTATCTGGGAGGTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097612
VALIDATED
GPR89A MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 89A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097612.1-269s21c1
Sequence:CCGGACTATGAGATACGTCAGTATGCTCGAGCATACTGACGTATCTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-1610s21c1
Sequence:CCGGTGGAACCAGGGCCTGACATTTCTCGAGAAATGTCAGGCCCTGGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-713s21c1
Sequence:CCGGATGTGACTGACACGGATATTCCTCGAGGAATATCCGTGTCAGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-372s21c1
Sequence:CCGGGAATAGCAGCTCCCGTTATTTCTCGAGAAATAACGGGAGCTGCTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001097612.1-204s21c1
Sequence:CCGGGATTACCTCCCAGATACTATTCTCGAGAATAGTATCTGGGAGGTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)