EMAIL THIS PAGE TO A FRIEND

GPR89B

G protein-coupled receptor 89B

45 Gene Product Result for
Synonyms: GPHR GPR89 SH120
Gene ID:
Rat(362003) G protein-coupled receptor 89B
chicken(418459) G protein-coupled receptor 89B
Domestic Rabbit(100358013) G protein-coupled receptor 89B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0051463M1 Monoclonal Anti-GPR89 antibody produced in mouse clone 4D8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016334 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016334 Rosetta Predictions human pricing
XM_001060170 Rosetta Predictions rat pricing
XM_342301 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349285 predicted 215
2 SASI_Hs01_00146722 predicted 960
3 SASI_Hs01_00146723 predicted 1294
4 SASI_Hs01_00146724 predicted 904
5 SASI_Hs01_00146725 predicted 1510
6 SASI_Hs02_00349286 predicted 1387
7 SASI_Hs01_00146726 predicted 1489
8 SASI_Hs01_00146728 predicted 1133
9 SASI_Hs01_00146729 predicted 236
10 SASI_Hs01_00146730 predicted 951
11 SASI_Hs01_00146727 predicted 930
12 SASI_Hs01_00146731 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295581 predicted 205
2 SASI_Rn02_00295582 predicted 273
3 SASI_Rn02_00295583 predicted 217
4 SASI_Rn02_00295584 predicted 841
5 SASI_Rn02_00295585 predicted 527
6 SASI_Rn02_00295586 predicted 1293
7 SASI_Rn02_00295587 predicted 1377
8 SASI_Rn02_00295588 predicted 929
9 SASI_Rn02_00295589 predicted 285
10 SASI_Rn02_00295590 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394067 predicted 841
2 SASI_Rn02_00394068 predicted 586
3 SASI_Rn02_00394069 predicted 273
4 SASI_Rn02_00394070 predicted 1036
5 SASI_Rn02_00394071 predicted 1111
6 SASI_Rn02_00394072 predicted 671
7 SASI_Rn02_00394073 predicted 935
8 SASI_Rn02_00394074 predicted 1128
9 SASI_Rn02_00394075 predicted 1013
10 SASI_Rn02_00394076 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016334
GPR89B MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 89B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016334.3-341s21c1
Sequence:CCGGTGAATAGCAGCTCCCGTTATTCTCGAGAATAACGGGAGCTGCTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016334.3-444s21c1
Sequence:CCGGCAATATCCGACTACTGCATAACTCGAGTTATGCAGTAGTCGGATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016334.3-175s21c1
Sequence:CCGGATTACCTCCCAGATACTATTTCTCGAGAAATAGTATCTGGGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016334.1-1740s1c1
Sequence:CCGGGCCAAGAAACTAAAGGTGAAACTCGAGTTTCACCTTTAGTTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-1243s1c1
Sequence:CCGGCCTGCTATTAGCACAGATAATCTCGAGATTATCTGTGCTAATAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-1402s1c1
Sequence:CCGGCGCTCTCTCTAGCATACTCTTCTCGAGAAGAGTATGCTAGAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-1134s1c1
Sequence:CCGGCCTTCATTCTTGTTGGAATAACTCGAGTTATTCCAACAAGAATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-182s1c1
Sequence:CCGGCGCCAATTGTTTAAAGACTATCTCGAGATAGTCTTTAAACAATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016334
GPR89B MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 89B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016334.3-341s21c1
Sequence:CCGGTGAATAGCAGCTCCCGTTATTCTCGAGAATAACGGGAGCTGCTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016334.3-444s21c1
Sequence:CCGGCAATATCCGACTACTGCATAACTCGAGTTATGCAGTAGTCGGATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016334.3-175s21c1
Sequence:CCGGATTACCTCCCAGATACTATTTCTCGAGAAATAGTATCTGGGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016334.1-1740s1c1
Sequence:CCGGGCCAAGAAACTAAAGGTGAAACTCGAGTTTCACCTTTAGTTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-1243s1c1
Sequence:CCGGCCTGCTATTAGCACAGATAATCTCGAGATTATCTGTGCTAATAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-1402s1c1
Sequence:CCGGCGCTCTCTCTAGCATACTCTTCTCGAGAAGAGTATGCTAGAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-1134s1c1
Sequence:CCGGCCTTCATTCTTGTTGGAATAACTCGAGTTATTCCAACAAGAATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-182s1c1
Sequence:CCGGCGCCAATTGTTTAAAGACTATCTCGAGATAGTCTTTAAACAATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016334
GPR89B MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 89B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016334.3-341s21c1
Sequence:CCGGTGAATAGCAGCTCCCGTTATTCTCGAGAATAACGGGAGCTGCTATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016334.3-444s21c1
Sequence:CCGGCAATATCCGACTACTGCATAACTCGAGTTATGCAGTAGTCGGATATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016334.3-175s21c1
Sequence:CCGGATTACCTCCCAGATACTATTTCTCGAGAAATAGTATCTGGGAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016334.1-1740s1c1
Sequence:CCGGGCCAAGAAACTAAAGGTGAAACTCGAGTTTCACCTTTAGTTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-1243s1c1
Sequence:CCGGCCTGCTATTAGCACAGATAATCTCGAGATTATCTGTGCTAATAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-1402s1c1
Sequence:CCGGCGCTCTCTCTAGCATACTCTTCTCGAGAAGAGTATGCTAGAGAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-1134s1c1
Sequence:CCGGCCTTCATTCTTGTTGGAATAACTCGAGTTATTCCAACAAGAATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016334.1-182s1c1
Sequence:CCGGCGCCAATTGTTTAAAGACTATCTCGAGATAGTCTTTAAACAATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks