EMAIL THIS PAGE TO A FRIEND

GPR89C

G protein-coupled receptor 89C

Species: Human GPR89C(728932)
UniProtKB ID: A6NKF9
Gene ID:
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001097616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097616 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097616 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318450 predicted 404
2 SASI_Hs02_00318451 predicted 746
3 SASI_Hs02_00318452 predicted 921
4 SASI_Hs02_00318453 predicted 354
5 SASI_Hs02_00318454 predicted 962
6 SASI_Hs02_00318455 predicted 832
7 SASI_Hs02_00318456 predicted 939
8 SASI_Hs02_00318457 predicted 558
9 SASI_Hs02_00318458 predicted 381
10 SASI_Hs02_00318459 predicted 581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097616
GPR89C MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 89C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-499s21c1
Sequence:CCGGTTCATGGCTACCATCAATATTCTCGAGAATATTGATGGTAGCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-805s21c1
Sequence:CCGGTTAGAATACCGCACCATAATCCTCGAGGATTATGGTGCGGTATTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097616.1-1293s21c1
Sequence:CCGGTGAGCCAAACACGTAGGATTTCTCGAGAAATCCTACGTGTTTGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-381s21c1
Sequence:CCGGTCTGGAAACAGCTGATCTATACTCGAGTATAGATCAGCTGTTTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-627s21c1
Sequence:CCGGCTTCATTCTTGTTGGAATAATCTCGAGATTATTCCAACAAGAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097616
GPR89C MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 89C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-499s21c1
Sequence:CCGGTTCATGGCTACCATCAATATTCTCGAGAATATTGATGGTAGCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-805s21c1
Sequence:CCGGTTAGAATACCGCACCATAATCCTCGAGGATTATGGTGCGGTATTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097616.1-1293s21c1
Sequence:CCGGTGAGCCAAACACGTAGGATTTCTCGAGAAATCCTACGTGTTTGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-381s21c1
Sequence:CCGGTCTGGAAACAGCTGATCTATACTCGAGTATAGATCAGCTGTTTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-627s21c1
Sequence:CCGGCTTCATTCTTGTTGGAATAATCTCGAGATTATTCCAACAAGAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097616
GPR89C MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 89C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-499s21c1
Sequence:CCGGTTCATGGCTACCATCAATATTCTCGAGAATATTGATGGTAGCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-805s21c1
Sequence:CCGGTTAGAATACCGCACCATAATCCTCGAGGATTATGGTGCGGTATTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001097616.1-1293s21c1
Sequence:CCGGTGAGCCAAACACGTAGGATTTCTCGAGAAATCCTACGTGTTTGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-381s21c1
Sequence:CCGGTCTGGAAACAGCTGATCTATACTCGAGTATAGATCAGCTGTTTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097616.1-627s21c1
Sequence:CCGGCTTCATTCTTGTTGGAATAATCTCGAGATTATTCCAACAAGAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks