EMAIL THIS PAGE TO A FRIEND

GPR97

G protein-coupled receptor 97

59 Gene Product Result for
Synonyms: PB99 PGR26
UniProtKB ID: Q86Y34, Q6ZMF4, Q86SL9, Q8IZF1
Gene ID:
Mouse(54672) G protein-coupled receptor 97
Rat(291854) G protein-coupled receptor 97
chicken(415632) G protein-coupled receptor 97
cow(529961) G protein-coupled receptor 97
Horse(100062648) G protein-coupled receptor 97
domestic cat(101092317) G protein-coupled receptor 97
dog(611191) G protein-coupled receptor 97
domestic guinea pig(100715242) G protein-coupled receptor 97
naked mole-rat(101724040) G protein-coupled receptor 97
sheep(101121194) G protein-coupled receptor 97
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173036 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173036 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173036 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_170776 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170776 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170776 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083951 MISSION® esiRNA esiRNA human GPR97 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170776 Rosetta Predictions human pricing
XM_001058038 Rosetta Predictions rat pricing
XM_226243 Rosetta Predictions rat pricing
NM_173036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049724 predicted 350
2 SASI_Hs01_00049725 predicted 1210
3 SASI_Hs01_00049726 predicted 390
4 SASI_Hs01_00049727 predicted 546
5 SASI_Hs01_00049728 predicted 480
6 SASI_Hs01_00049729 predicted 964
7 SASI_Hs01_00049730 predicted 872
8 SASI_Hs02_00367748 predicted 1183
9 SASI_Hs01_00049731 predicted 757
10 SASI_Hs01_00049732 predicted 1368
11 SASI_Hs01_00049733 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288365 predicted 967
2 SASI_Rn02_00288366 predicted 1722
3 SASI_Rn02_00288367 predicted 1704
4 SASI_Rn02_00288368 predicted 1672
5 SASI_Rn02_00288369 predicted 484
6 SASI_Rn02_00288370 predicted 943
7 SASI_Rn02_00288371 predicted 1321
8 SASI_Rn02_00288372 predicted 1305
9 SASI_Rn02_00288373 predicted 1543
10 SASI_Rn02_00288374 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383432 predicted 973
2 SASI_Rn02_00383433 predicted 1725
3 SASI_Rn02_00383434 predicted 1399
4 SASI_Rn02_00383435 predicted 1432
5 SASI_Rn02_00383436 predicted 944
6 SASI_Rn02_00383437 predicted 1377
7 SASI_Rn02_00383438 predicted 1328
8 SASI_Rn02_00383439 predicted 1308
9 SASI_Rn02_00383440 predicted 1539
10 SASI_Rn02_00383441 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112980 predicted 1272
2 SASI_Mm01_00112981 predicted 1753
3 SASI_Mm01_00112982 predicted 1700
4 SASI_Mm01_00112983 predicted 232
5 SASI_Mm01_00112984 predicted 674
6 SASI_Mm01_00112985 predicted 478
7 SASI_Mm01_00112986 predicted 1511
8 SASI_Mm01_00112987 predicted 237
9 SASI_Mm01_00112988 predicted 1282
10 SASI_Mm01_00112989 predicted 1143
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173036
GPR97 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 97
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173036.3-1228s21c1
Sequence:CCGGTGCCTGTTCTTGTAGTTATTGCTCGAGCAATAACTACAAGAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173036.3-1996s21c1
Sequence:CCGGGCATGAATGTGCTGGATATATCTCGAGATATATCCAGCACATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-482s1c1
Sequence:CCGGGCCATAACTGTTCTAGACATTCTCGAGAATGTCTAGAACAGTTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-1211s1c1
Sequence:CCGGGCTGGAAGTAGCAACAGTTATCTCGAGATAACTGTTGCTACTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-661s1c1
Sequence:CCGGCGTGATCCTCACCTGTGTATTCTCGAGAATACACAGGTGAGGATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-976s1c1
Sequence:CCGGCCTGAATCTTACCTTCCTGATCTCGAGATCAGGAAGGTAAGATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173036.2-2111s1c1
Sequence:CCGGCCCAGCCAACAGTGTTATCTTCTCGAGAAGATAACACTGTTGGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173036
GPR97 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 97
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173036.3-1228s21c1
Sequence:CCGGTGCCTGTTCTTGTAGTTATTGCTCGAGCAATAACTACAAGAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173036.3-1996s21c1
Sequence:CCGGGCATGAATGTGCTGGATATATCTCGAGATATATCCAGCACATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-482s1c1
Sequence:CCGGGCCATAACTGTTCTAGACATTCTCGAGAATGTCTAGAACAGTTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-1211s1c1
Sequence:CCGGGCTGGAAGTAGCAACAGTTATCTCGAGATAACTGTTGCTACTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-661s1c1
Sequence:CCGGCGTGATCCTCACCTGTGTATTCTCGAGAATACACAGGTGAGGATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-976s1c1
Sequence:CCGGCCTGAATCTTACCTTCCTGATCTCGAGATCAGGAAGGTAAGATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173036.2-2111s1c1
Sequence:CCGGCCCAGCCAACAGTGTTATCTTCTCGAGAAGATAACACTGTTGGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173036
GPR97 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 97
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173036.3-1228s21c1
Sequence:CCGGTGCCTGTTCTTGTAGTTATTGCTCGAGCAATAACTACAAGAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173036.3-1996s21c1
Sequence:CCGGGCATGAATGTGCTGGATATATCTCGAGATATATCCAGCACATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-482s1c1
Sequence:CCGGGCCATAACTGTTCTAGACATTCTCGAGAATGTCTAGAACAGTTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-1211s1c1
Sequence:CCGGGCTGGAAGTAGCAACAGTTATCTCGAGATAACTGTTGCTACTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-661s1c1
Sequence:CCGGCGTGATCCTCACCTGTGTATTCTCGAGAATACACAGGTGAGGATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173036.2-976s1c1
Sequence:CCGGCCTGAATCTTACCTTCCTGATCTCGAGATCAGGAAGGTAAGATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004656    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173036.2-2111s1c1
Sequence:CCGGCCCAGCCAACAGTGTTATCTTCTCGAGAAGATAACACTGTTGGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170776
GPR97 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 97
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170776.4-1315s21c1
Sequence:CCGGCCTCTACACCATCCGTGATAGCTCGAGCTATCACGGATGGTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170776.4-1909s21c1
Sequence:CCGGTCCCATCCAGATCCAACTATACTCGAGTATAGTTGGATCTGGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170776.4-1382s21c1
Sequence:CCGGACCATGTACGCCCTCTATATCCTCGAGGATATAGAGGGCGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170776.4-948s21c1
Sequence:CCGGTCCTGGCCTTCACCATTATTCCTCGAGGAATAATGGTGAAGGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170776.3-2434s1c1
Sequence:CCGGGCTGTCATCATAGAGGTAGAACTCGAGTTCTACCTCTATGATGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-215s1c1
Sequence:CCGGCAACTTGAATGACAAGGCTTTCTCGAGAAAGCCTTGTCATTCAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-1365s1c1
Sequence:CCGGACAACCATGTACGCCCTCTATCTCGAGATAGAGGGCGTACATGGTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-1594s1c1
Sequence:CCGGCCGTCTACATCTTTGCACTTTCTCGAGAAAGTGCAAAGATGTAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-290s1c1
Sequence:CCGGGCAGAGATACTGGCTAAACTACTCGAGTAGTTTAGCCAGTATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170776
GPR97 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 97
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170776.4-1315s21c1
Sequence:CCGGCCTCTACACCATCCGTGATAGCTCGAGCTATCACGGATGGTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170776.4-1909s21c1
Sequence:CCGGTCCCATCCAGATCCAACTATACTCGAGTATAGTTGGATCTGGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170776.4-1382s21c1
Sequence:CCGGACCATGTACGCCCTCTATATCCTCGAGGATATAGAGGGCGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170776.4-948s21c1
Sequence:CCGGTCCTGGCCTTCACCATTATTCCTCGAGGAATAATGGTGAAGGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170776.3-2434s1c1
Sequence:CCGGGCTGTCATCATAGAGGTAGAACTCGAGTTCTACCTCTATGATGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-215s1c1
Sequence:CCGGCAACTTGAATGACAAGGCTTTCTCGAGAAAGCCTTGTCATTCAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-1365s1c1
Sequence:CCGGACAACCATGTACGCCCTCTATCTCGAGATAGAGGGCGTACATGGTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-1594s1c1
Sequence:CCGGCCGTCTACATCTTTGCACTTTCTCGAGAAAGTGCAAAGATGTAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-290s1c1
Sequence:CCGGGCAGAGATACTGGCTAAACTACTCGAGTAGTTTAGCCAGTATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170776
GPR97 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 97
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170776.4-1315s21c1
Sequence:CCGGCCTCTACACCATCCGTGATAGCTCGAGCTATCACGGATGGTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170776.4-1909s21c1
Sequence:CCGGTCCCATCCAGATCCAACTATACTCGAGTATAGTTGGATCTGGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170776.4-1382s21c1
Sequence:CCGGACCATGTACGCCCTCTATATCCTCGAGGATATAGAGGGCGTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170776.4-948s21c1
Sequence:CCGGTCCTGGCCTTCACCATTATTCCTCGAGGAATAATGGTGAAGGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170776.3-2434s1c1
Sequence:CCGGGCTGTCATCATAGAGGTAGAACTCGAGTTCTACCTCTATGATGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-215s1c1
Sequence:CCGGCAACTTGAATGACAAGGCTTTCTCGAGAAAGCCTTGTCATTCAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-1365s1c1
Sequence:CCGGACAACCATGTACGCCCTCTATCTCGAGATAGAGGGCGTACATGGTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-1594s1c1
Sequence:CCGGCCGTCTACATCTTTGCACTTTCTCGAGAAAGTGCAAAGATGTAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170776.3-290s1c1
Sequence:CCGGGCAGAGATACTGGCTAAACTACTCGAGTAGTTTAGCCAGTATCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks