EMAIL THIS PAGE TO A FRIEND

GPR98

G protein-coupled receptor 98

84 Gene Product Result for
Synonyms: FEB4 MASS1 USH2B USH2C VLGR1 VLGR1b
UniProtKB ID: Q8WXG9, O75171, Q8TF58, Q9H0X5, Q9UL61
Gene ID:
Human(84059) Summary: This gene encodes a member of the G-protein coupled receptor superfamily. The encoded protein contains a 7-transmembrane receptor domain, binds calcium and is expressed in the central nervous system. Mutations in this gene are associated with Usher syndrome 2 and familial febrile seizures. Several alternatively spliced transcripts have been described. [provided by RefSeq, Jul 2008]
Mouse(110789) G protein-coupled receptor 98
Rat(685383) G protein-coupled receptor 98
sheep(101120749) G protein-coupled receptor 98
Domestic Rabbit(100346973) G protein-coupled receptor 98
domestic guinea pig(100723142) G protein-coupled receptor 98
naked mole-rat(101700242) G protein-coupled receptor 98
Zebrafish(415105) G protein-coupled receptor 98
cow(537034) G protein-coupled receptor 98
Horse(100073239) G protein-coupled receptor 98
domestic cat(101100444) G protein-coupled receptor 98
dog(479153) G protein-coupled receptor 98
chicken(431566) G protein-coupled receptor 98
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_358310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032119 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098051 MISSION® esiRNA esiRNA human GPR98 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032119 Rosetta Predictions human pricing
NR_003149 Rosetta Predictions human pricing
XM_001063571 Rosetta Predictions rat pricing
NM_054053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135379 predicted 6350
2 SASI_Hs01_00135381 predicted 7154
3 SASI_Hs01_00135382 predicted 5894
4 SASI_Hs01_00135383 predicted 3520
5 SASI_Hs01_00135384 predicted 17308
6 SASI_Hs02_00359320 predicted 6561
7 SASI_Hs02_00359321 predicted 10687
8 SASI_Hs01_00135387 predicted 11282
9 SASI_Hs02_00359322 predicted 1692
10 SASI_Hs02_00359323 predicted 6335
11 SASI_Hs01_00135380 predicted 10731
12 SASI_Hs01_00135385 predicted 403
13 SASI_Hs01_00135386 predicted 8606
14 SASI_Hs01_00135388 predicted 6406
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378487 predicted 6342
2 SASI_Hs02_00378488 predicted 7072
3 SASI_Hs02_00378489 predicted 5886
4 SASI_Hs02_00378490 predicted 3517
5 SASI_Hs02_00378491 predicted 17229
6 SASI_Hs02_00378492 predicted 6560
7 SASI_Hs02_00378493 predicted 10598
8 SASI_Hs02_00378494 predicted 11195
9 SASI_Hs02_00378495 predicted 1686
10 SASI_Hs02_00378496 predicted 6327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307644 predicted 275
2 SASI_Rn02_00307645 predicted 1895
3 SASI_Rn02_00307646 predicted 2107
4 SASI_Rn02_00307647 predicted 1134
5 SASI_Rn02_00307648 predicted 926
6 SASI_Rn02_00307649 predicted 1622
7 SASI_Rn02_00307650 predicted 2452
8 SASI_Rn02_00307651 predicted 2445
9 SASI_Rn02_00307652 predicted 1550
10 SASI_Rn02_00307653 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110418 predicted 4390
2 SASI_Mm02_00337963 predicted 9768
3 SASI_Mm01_00110420 predicted 3796
4 SASI_Mm02_00337964 predicted 18909
5 SASI_Mm01_00110424 predicted 10604
6 SASI_Mm01_00110425 predicted 4154
7 SASI_Mm01_00110426 predicted 8631
8 SASI_Mm02_00337965 predicted 19081
9 SASI_Mm02_00337966 predicted 1560
10 SASI_Mm02_00337967 predicted 13963
11 SASI_Mm01_00110419 predicted 3000
12 SASI_Mm01_00110421 predicted 17799
13 SASI_Mm01_00110422 predicted 13213
14 SASI_Mm01_00110423 predicted 6092
15 SASI_Mm01_00110427 predicted 11102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358310
GPR98 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 98
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-4138s1c1
Sequence:CCGGCCACCAATGATAGACTTTATACTCGAGTATAAAGTCTATCATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-2468s1c1
Sequence:CCGGCGGAGTTGAATGAAACTGTAACTCGAGTTACAGTTTCATTCAACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-6319s1c1
Sequence:CCGGCCACCGTATTTCCCACCTAATCTCGAGATTAGGTGGGAAATACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-1236s1c1
Sequence:CCGGGCCGGATACTACTCTTGTCTTCTCGAGAAGACAAGAGTAGTATCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-8138s1c1
Sequence:CCGGCGGCTACTGAAGGTTTAGATTCTCGAGAATCTAAACCTTCAGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358310
GPR98 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 98
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-4138s1c1
Sequence:CCGGCCACCAATGATAGACTTTATACTCGAGTATAAAGTCTATCATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-2468s1c1
Sequence:CCGGCGGAGTTGAATGAAACTGTAACTCGAGTTACAGTTTCATTCAACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-6319s1c1
Sequence:CCGGCCACCGTATTTCCCACCTAATCTCGAGATTAGGTGGGAAATACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-1236s1c1
Sequence:CCGGGCCGGATACTACTCTTGTCTTCTCGAGAAGACAAGAGTAGTATCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-8138s1c1
Sequence:CCGGCGGCTACTGAAGGTTTAGATTCTCGAGAATCTAAACCTTCAGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358310
GPR98 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 98
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-4138s1c1
Sequence:CCGGCCACCAATGATAGACTTTATACTCGAGTATAAAGTCTATCATTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-2468s1c1
Sequence:CCGGCGGAGTTGAATGAAACTGTAACTCGAGTTACAGTTTCATTCAACTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-6319s1c1
Sequence:CCGGCCACCGTATTTCCCACCTAATCTCGAGATTAGGTGGGAAATACGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-1236s1c1
Sequence:CCGGGCCGGATACTACTCTTGTCTTCTCGAGAAGACAAGAGTAGTATCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358310.1-8138s1c1
Sequence:CCGGCGGCTACTGAAGGTTTAGATTCTCGAGAATCTAAACCTTCAGTAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032119
GPR98 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 98
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-7123s1c1
Sequence:CCGGCCTGCCAATGATGATCCTTATCTCGAGATAAGGATCATCATTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-2541s1c1
Sequence:CCGGGCCAAGAGATAGCAATGAATTCTCGAGAATTCATTGCTATCTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-18863s1c1
Sequence:CCGGCCCAGGAGTTTGATGATTTAACTCGAGTTAAATCATCAAACTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-14763s1c1
Sequence:CCGGCGGATTTGAATCCACTGCTTTCTCGAGAAAGCAGTGGATTCAAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032119.1-19042s1c1
Sequence:CCGGGAGCACACTTTCATATTTGTACTCGAGTACAAATATGAAAGTGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032119.3-9774s21c1
Sequence:CCGGTCGAACTAATGGCATTGATTTCTCGAGAAATCAATGCCATTAGTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032119.3-2372s21c1
Sequence:CCGGATACTAGCCGTGACCTAATTACTCGAGTAATTAGGTCACGGCTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032119.3-9534s21c1
Sequence:CCGGTCGATTCAAGGCCCTACAAATCTCGAGATTTGTAGGGCCTTGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032119
GPR98 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 98
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-7123s1c1
Sequence:CCGGCCTGCCAATGATGATCCTTATCTCGAGATAAGGATCATCATTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-2541s1c1
Sequence:CCGGGCCAAGAGATAGCAATGAATTCTCGAGAATTCATTGCTATCTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-18863s1c1
Sequence:CCGGCCCAGGAGTTTGATGATTTAACTCGAGTTAAATCATCAAACTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-14763s1c1
Sequence:CCGGCGGATTTGAATCCACTGCTTTCTCGAGAAAGCAGTGGATTCAAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032119.1-19042s1c1
Sequence:CCGGGAGCACACTTTCATATTTGTACTCGAGTACAAATATGAAAGTGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032119.3-9774s21c1
Sequence:CCGGTCGAACTAATGGCATTGATTTCTCGAGAAATCAATGCCATTAGTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032119.3-2372s21c1
Sequence:CCGGATACTAGCCGTGACCTAATTACTCGAGTAATTAGGTCACGGCTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032119.3-9534s21c1
Sequence:CCGGTCGATTCAAGGCCCTACAAATCTCGAGATTTGTAGGGCCTTGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032119
GPR98 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 98
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-7123s1c1
Sequence:CCGGCCTGCCAATGATGATCCTTATCTCGAGATAAGGATCATCATTGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-2541s1c1
Sequence:CCGGGCCAAGAGATAGCAATGAATTCTCGAGAATTCATTGCTATCTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-18863s1c1
Sequence:CCGGCCCAGGAGTTTGATGATTTAACTCGAGTTAAATCATCAAACTCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032119.1-14763s1c1
Sequence:CCGGCGGATTTGAATCCACTGCTTTCTCGAGAAAGCAGTGGATTCAAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032119.1-19042s1c1
Sequence:CCGGGAGCACACTTTCATATTTGTACTCGAGTACAAATATGAAAGTGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032119.3-9774s21c1
Sequence:CCGGTCGAACTAATGGCATTGATTTCTCGAGAAATCAATGCCATTAGTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032119.3-2372s21c1
Sequence:CCGGATACTAGCCGTGACCTAATTACTCGAGTAATTAGGTCACGGCTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032119.3-9534s21c1
Sequence:CCGGTCGATTCAAGGCCCTACAAATCTCGAGATTTGTAGGGCCTTGAATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks