EMAIL THIS PAGE TO A FRIEND

GPRASP1

G protein-coupled receptor associated sorting protein 1

155 Gene Product Result for
Synonyms: GASP GASP-1 GASP1
UniProtKB ID: Q5JY77, O43168, Q96LA1
Gene ID:
Human(9737) Summary: This gene encodes a member of the GPRASP (G protein-coupled receptor associated sorting protein) family. The protein may modulate lysosomal sorting and functional down-regulation of a variety of G-protein coupled receptors. It targets receptors for degradation in lysosomes. The receptors interacting with this sorting protein include D2 dopamine receptor (DRD2), delta opioid receptor (OPRD1), beta-2 adrenergic receptor (ADRB2), D4 dopamine receptor (DRD4) and cannabinoid 1 receptor (CB1R). Multiple alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, May 2010]
Mouse(67298) G protein-coupled receptor associated sorting protein 1
Rat(171407) G protein-coupled receptor associated sorting protein 1
dog(480996) G protein-coupled receptor associated sorting protein 1
cow(100124524) G protein-coupled receptor associated sorting protein 1
domestic cat(101090755) G protein-coupled receptor associated sorting protein 1
domestic guinea pig(100716172) G protein-coupled receptor associated sorting protein 1
naked mole-rat(101698781) G protein-coupled receptor associated sorting protein 1
sheep(101123017) G protein-coupled receptor associated sorting protein 1
Domestic Rabbit(100343091) G protein-coupled receptor associated sorting protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014710 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101671 MISSION® esiRNA esiRNA human GPRASP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099410 Rosetta Predictions human pricing
NM_001099411 Rosetta Predictions human pricing
NM_014710 Rosetta Predictions human pricing
NM_134386 Rosetta Predictions rat pricing
NM_001004359 Rosetta Predictions mouse pricing
NM_001005385 Rosetta Predictions mouse pricing
NM_026081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320629 predicted 2472
2 SASI_Hs02_00320630 predicted 2096
3 SASI_Hs02_00320631 predicted 1437
4 SASI_Hs02_00320632 predicted 1967
5 SASI_Hs02_00320633 predicted 953
6 SASI_Hs02_00320634 predicted 1029
7 SASI_Hs02_00320635 predicted 4498
8 SASI_Hs02_00320636 predicted 4526
9 SASI_Hs02_00320637 predicted 1538
10 SASI_Hs02_00320638 predicted 2646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320639 predicted 2411
2 SASI_Hs02_00320640 predicted 2022
3 SASI_Hs02_00320641 predicted 1370
4 SASI_Hs02_00320642 predicted 1895
5 SASI_Hs02_00320643 predicted 885
6 SASI_Hs02_00320644 predicted 965
7 SASI_Hs02_00320645 predicted 4427
8 SASI_Hs02_00320646 predicted 4459
9 SASI_Hs02_00320647 predicted 1468
10 SASI_Hs02_00320648 predicted 2578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211913 predicted 2567
2 SASI_Hs02_00346132 predicted 2187
3 SASI_Hs01_00211914 predicted 1523
4 SASI_Hs02_00346133 predicted 2054
5 SASI_Hs01_00211916 predicted 1040
6 SASI_Hs01_00211917 predicted 1125
7 SASI_Hs01_00211918 predicted 4591
8 SASI_Hs02_00346134 predicted 4619
9 SASI_Hs01_00211919 predicted 1632
10 SASI_Hs01_00211920 predicted 2740
11 SASI_Hs01_00211911 predicted 857
12 SASI_Hs01_00211912 predicted 4217
13 SASI_Hs01_00211915 predicted 4006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267950 predicted 4181
2 SASI_Rn01_00109801 predicted 4774
3 SASI_Rn01_00109802 predicted 4871
4 SASI_Rn02_00267951 predicted 3226
5 SASI_Rn01_00109803 predicted 3919
6 SASI_Rn02_00267952 predicted 3480
7 SASI_Rn01_00109804 predicted 3264
8 SASI_Rn01_00109806 predicted 2902
9 SASI_Rn01_00109808 predicted 3800
10 SASI_Rn02_00267953 predicted 2497
11 SASI_Rn01_00109800 predicted 5407
12 SASI_Rn01_00109805 predicted 5674
13 SASI_Rn01_00109807 predicted 5505
14 SASI_Rn01_00109809 predicted 2213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066548 predicted 1764
2 SASI_Mm01_00066549 predicted 3586
3 SASI_Mm01_00066550 predicted 2066
4 SASI_Mm01_00066551 predicted 2672
5 SASI_Mm02_00286528 predicted 4683
6 SASI_Mm02_00286529 predicted 3579
7 SASI_Mm01_00066553 predicted 1918
8 SASI_Mm01_00066554 predicted 2614
9 SASI_Mm01_00066555 predicted 5053
10 SASI_Mm01_00066556 predicted 4941
11 SASI_Mm01_00066552 predicted 3890
12 SASI_Mm01_00066557 predicted 2037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165874 predicted 1647
2 SASI_Mm01_00165875 predicted 3476
3 SASI_Mm01_00165876 predicted 1951
4 SASI_Mm01_00165877 predicted 2556
5 SASI_Mm02_00286573 predicted 4575
6 SASI_Mm02_00286574 predicted 3461
7 SASI_Mm01_00165879 predicted 1804
8 SASI_Mm01_00165880 predicted 2497
9 SASI_Mm01_00165881 predicted 4937
10 SASI_Mm01_00165882 predicted 4829
11 SASI_Mm01_00165878 predicted 3784
12 SASI_Mm01_00165883 predicted 1927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046677 predicted 1851
2 SASI_Mm01_00046679 predicted 3683
3 SASI_Mm01_00046681 predicted 2156
4 SASI_Mm01_00046682 predicted 2760
5 SASI_Mm02_00329657 predicted 4777
6 SASI_Mm02_00329658 predicted 3669
7 SASI_Mm01_00046684 predicted 2011
8 SASI_Mm01_00046685 predicted 2702
9 SASI_Mm01_00046686 predicted 5135
10 SASI_Mm02_00329659 predicted 5035
11 SASI_Mm01_00046678 predicted 4874
12 SASI_Mm01_00046680 predicted 2947
13 SASI_Mm01_00046683 predicted 3980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014710
GPRASP1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor associated sorting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-4880s21c1
Sequence:CCGGTCAATATTGAGCCGCTTATTTCTCGAGAAATAAGCGGCTCAATATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-1211s21c1
Sequence:CCGGAGGATAGAGAACTGGTTAATACTCGAGTATTAACCAGTTCTCTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-1045s21c1
Sequence:CCGGGCAATACCTGTTTCACGATTTCTCGAGAAATCGTGAAACAGGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-1522s21c1
Sequence:CCGGACTAACCAGGAGCTCTATATTCTCGAGAATATAGAGCTCCTGGTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014710.1-4892s1c1
Sequence:CCGGCCTTGAGTAATGCTTTGATTTCTCGAGAAATCAAAGCATTACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-3066s1c1
Sequence:CCGGGCTGAGAAAGAAGGTATTGTTCTCGAGAACAATACCTTCTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-3873s1c1
Sequence:CCGGGCAGCATCTTTATTCTGTGAACTCGAGTTCACAGAATAAAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-807s1c1
Sequence:CCGGCCCAAGAATAAGTCCAAGGTTCTCGAGAACCTTGGACTTATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-4384s1c1
Sequence:CCGGCCCTTGCTTATAGCGTGGATTCTCGAGAATCCACGCTATAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014710
GPRASP1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor associated sorting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-4880s21c1
Sequence:CCGGTCAATATTGAGCCGCTTATTTCTCGAGAAATAAGCGGCTCAATATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-1211s21c1
Sequence:CCGGAGGATAGAGAACTGGTTAATACTCGAGTATTAACCAGTTCTCTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-1045s21c1
Sequence:CCGGGCAATACCTGTTTCACGATTTCTCGAGAAATCGTGAAACAGGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-1522s21c1
Sequence:CCGGACTAACCAGGAGCTCTATATTCTCGAGAATATAGAGCTCCTGGTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014710.1-4892s1c1
Sequence:CCGGCCTTGAGTAATGCTTTGATTTCTCGAGAAATCAAAGCATTACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-3066s1c1
Sequence:CCGGGCTGAGAAAGAAGGTATTGTTCTCGAGAACAATACCTTCTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-3873s1c1
Sequence:CCGGGCAGCATCTTTATTCTGTGAACTCGAGTTCACAGAATAAAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-807s1c1
Sequence:CCGGCCCAAGAATAAGTCCAAGGTTCTCGAGAACCTTGGACTTATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-4384s1c1
Sequence:CCGGCCCTTGCTTATAGCGTGGATTCTCGAGAATCCACGCTATAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014710
GPRASP1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor associated sorting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-4880s21c1
Sequence:CCGGTCAATATTGAGCCGCTTATTTCTCGAGAAATAAGCGGCTCAATATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-1211s21c1
Sequence:CCGGAGGATAGAGAACTGGTTAATACTCGAGTATTAACCAGTTCTCTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-1045s21c1
Sequence:CCGGGCAATACCTGTTTCACGATTTCTCGAGAAATCGTGAAACAGGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014710.4-1522s21c1
Sequence:CCGGACTAACCAGGAGCTCTATATTCTCGAGAATATAGAGCTCCTGGTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014710.1-4892s1c1
Sequence:CCGGCCTTGAGTAATGCTTTGATTTCTCGAGAAATCAAAGCATTACTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-3066s1c1
Sequence:CCGGGCTGAGAAAGAAGGTATTGTTCTCGAGAACAATACCTTCTTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-3873s1c1
Sequence:CCGGGCAGCATCTTTATTCTGTGAACTCGAGTTCACAGAATAAAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-807s1c1
Sequence:CCGGCCCAAGAATAAGTCCAAGGTTCTCGAGAACCTTGGACTTATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014710.1-4384s1c1
Sequence:CCGGCCCTTGCTTATAGCGTGGATTCTCGAGAATCCACGCTATAAGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026081
GPRASP1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor associated sorting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-783s1c1
Sequence:CCGGCCGATTTCAAATGGGCAGATACTCGAGTATCTGCCCATTTGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-1600s1c1
Sequence:CCGGGCAAGTTAGTAGTTTCTGTTTCTCGAGAAACAGAAACTACTAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-580s1c1
Sequence:CCGGGCTCAGTAATGATTCTGGGATCTCGAGATCCCAGAATCATTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-1292s1c1
Sequence:CCGGCCTGAAGAGAAAGCTAATGTTCTCGAGAACATTAGCTTTCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-2255s1c1
Sequence:CCGGCCCTGTTTGTATCCTACCAATCTCGAGATTGGTAGGATACAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026081
GPRASP1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor associated sorting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-783s1c1
Sequence:CCGGCCGATTTCAAATGGGCAGATACTCGAGTATCTGCCCATTTGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-1600s1c1
Sequence:CCGGGCAAGTTAGTAGTTTCTGTTTCTCGAGAAACAGAAACTACTAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-580s1c1
Sequence:CCGGGCTCAGTAATGATTCTGGGATCTCGAGATCCCAGAATCATTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-1292s1c1
Sequence:CCGGCCTGAAGAGAAAGCTAATGTTCTCGAGAACATTAGCTTTCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-2255s1c1
Sequence:CCGGCCCTGTTTGTATCCTACCAATCTCGAGATTGGTAGGATACAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026081
GPRASP1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor associated sorting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-783s1c1
Sequence:CCGGCCGATTTCAAATGGGCAGATACTCGAGTATCTGCCCATTTGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-1600s1c1
Sequence:CCGGGCAAGTTAGTAGTTTCTGTTTCTCGAGAAACAGAAACTACTAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-580s1c1
Sequence:CCGGGCTCAGTAATGATTCTGGGATCTCGAGATCCCAGAATCATTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-1292s1c1
Sequence:CCGGCCTGAAGAGAAAGCTAATGTTCTCGAGAACATTAGCTTTCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026081.3-2255s1c1
Sequence:CCGGCCCTGTTTGTATCCTACCAATCTCGAGATTGGTAGGATACAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks