EMAIL THIS PAGE TO A FRIEND

GPRASP2

G protein-coupled receptor associated sorting protein 2

117 Gene Product Result for
Synonyms: GASP2
UniProtKB ID: Q96D09, D3DXA0, Q8NAB4
Gene ID:
Human(114928) Summary: The protein encoded by this gene is a member of a family that regulates the activity of G protein-coupled receptors (GPCRs). The encoded protein has been shown to be capable of interacting with several GPCRs, including the M1 muscarinic acetylcholine receptor and the calcitonin receptor. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
Mouse(245607) G protein-coupled receptor associated sorting protein 2
Rat(317405) G protein-coupled receptor associated sorting protein 2
Domestic Rabbit(100341566) G protein-coupled receptor associated sorting protein 2
domestic guinea pig(100717281) G protein-coupled receptor associated sorting protein 2
dog(100688489) G protein-coupled receptor associated sorting protein 2
Horse(100069454) G protein-coupled receptor associated sorting protein 2
domestic cat(101091004) G protein-coupled receptor associated sorting protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004051 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004051 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004051 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001474790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001474790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001474790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004051 Rosetta Predictions human pricing
NM_138437 Rosetta Predictions human pricing
XM_001054048 Rosetta Predictions rat pricing
XM_228821 Rosetta Predictions rat pricing
XM_001474790 Rosetta Predictions mouse pricing
XM_001474818 Rosetta Predictions mouse pricing
XM_001481276 Rosetta Predictions mouse pricing
XM_142154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182132 predicted 1761
2 SASI_Hs01_00182133 predicted 2825
3 SASI_Hs01_00182135 predicted 3207
4 SASI_Hs01_00182136 predicted 1478
5 SASI_Hs01_00182137 predicted 3267
6 SASI_Hs02_00304443 predicted 1688
7 SASI_Hs01_00182138 predicted 1520
8 SASI_Hs02_00304444 predicted 3151
9 SASI_Hs02_00304445 predicted 2661
10 SASI_Hs01_00182141 predicted 3084
11 SASI_Hs01_00182134 predicted 2502
12 SASI_Hs01_00182139 predicted 2050
13 SASI_Hs01_00182140 predicted 2604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196821 predicted 1676
2 SASI_Hs01_00196822 predicted 2734
3 SASI_Hs01_00196824 predicted 3123
4 SASI_Hs01_00196825 predicted 1394
5 SASI_Hs01_00196826 predicted 3182
6 SASI_Hs02_00363596 predicted 1607
7 SASI_Hs01_00196827 predicted 1431
8 SASI_Hs02_00363597 predicted 3059
9 SASI_Hs02_00363598 predicted 2572
10 SASI_Hs01_00196830 predicted 2993
11 SASI_Hs01_00196823 predicted 2408
12 SASI_Hs01_00196828 predicted 1959
13 SASI_Hs01_00196829 predicted 2514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274497 predicted 2253
2 SASI_Rn02_00274498 predicted 2196
3 SASI_Rn02_00274499 predicted 2138
4 SASI_Rn02_00274500 predicted 2280
5 SASI_Rn02_00274501 predicted 497
6 SASI_Rn02_00274502 predicted 2107
7 SASI_Rn02_00274503 predicted 527
8 SASI_Rn02_00274504 predicted 1430
9 SASI_Rn02_00274505 predicted 2528
10 SASI_Rn02_00274506 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385565 predicted 2428
2 SASI_Rn02_00385566 predicted 943
3 SASI_Rn02_00385567 predicted 2259
4 SASI_Rn02_00385568 predicted 2193
5 SASI_Rn02_00385569 predicted 2135
6 SASI_Rn02_00385570 predicted 2041
7 SASI_Rn02_00385571 predicted 2282
8 SASI_Rn02_00385572 predicted 2113
9 SASI_Rn02_00385573 predicted 1430
10 SASI_Rn02_00385574 predicted 2526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00377851 predicted 3228
2 SASI_Mm02_00377852 predicted 3015
3 SASI_Mm02_00377853 predicted 2835
4 SASI_Mm02_00377854 predicted 1692
5 SASI_Mm02_00377855 predicted 1381
6 SASI_Mm02_00377856 predicted 1412
7 SASI_Mm02_00377857 predicted 1776
8 SASI_Mm02_00377858 predicted 3061
9 SASI_Mm02_00377859 predicted 3023
10 SASI_Mm02_00377860 predicted 2392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00378035 predicted 3183
2 SASI_Mm02_00378036 predicted 2964
3 SASI_Mm02_00378037 predicted 2787
4 SASI_Mm02_00378038 predicted 1644
5 SASI_Mm02_00378039 predicted 1331
6 SASI_Mm02_00378040 predicted 1363
7 SASI_Mm02_00378041 predicted 1732
8 SASI_Mm02_00378042 predicted 3011
9 SASI_Mm02_00378043 predicted 2978
10 SASI_Mm02_00378044 predicted 2334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423336 predicted 756
2 SASI_Mm02_00423337 predicted 530
3 SASI_Mm02_00423338 predicted 354
4 SASI_Mm02_00423339 predicted 350
5 SASI_Mm02_00423340 predicted 964
6 SASI_Mm02_00423341 predicted 583
7 SASI_Mm02_00423342 predicted 550
8 SASI_Mm02_00423343 predicted 550
9 SASI_Mm02_00423344 predicted 573
10 SASI_Mm02_00423345 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_142154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264920 predicted 3209
2 SASI_Mm01_00264921 predicted 2987
3 SASI_Mm02_00425123 predicted 2811
4 SASI_Mm01_00264922 predicted 1670
5 SASI_Mm01_00264925 predicted 1349
6 SASI_Mm01_00264926 predicted 1385
7 SASI_Mm01_00264927 predicted 1749
8 SASI_Mm01_00264928 predicted 3035
9 SASI_Mm02_00425124 predicted 2996
10 SASI_Mm02_00425125 predicted 2358
11 SASI_Mm01_00264919 predicted 3169
12 SASI_Mm01_00264923 predicted 2766
13 SASI_Mm01_00264924 predicted 3420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004051
GPRASP2 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor associated sorting protein 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000062873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004051.1-3430s1c1
Sequence:CCGGGCTGTCCAGATTGCGGTATTTCTCGAGAAATACCGCAATCTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004051.1-2035s21c1
Sequence:CCGGTCTGAAGAAGAGGCCATATTTCTCGAGAAATATGGCCTCTTCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004051.1-1021s21c1
Sequence:CCGGGTAGGTGGCGCTCGTTCTAAACTCGAGTTTAGAACGAGCGCCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004051.1-3116s21c1
Sequence:CCGGTCAGTCTTGAGCCGCTTATTTCTCGAGAAATAAGCGGCTCAAGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004051
GPRASP2 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor associated sorting protein 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000062873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004051.1-3430s1c1
Sequence:CCGGGCTGTCCAGATTGCGGTATTTCTCGAGAAATACCGCAATCTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004051.1-2035s21c1
Sequence:CCGGTCTGAAGAAGAGGCCATATTTCTCGAGAAATATGGCCTCTTCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004051.1-1021s21c1
Sequence:CCGGGTAGGTGGCGCTCGTTCTAAACTCGAGTTTAGAACGAGCGCCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004051.1-3116s21c1
Sequence:CCGGTCAGTCTTGAGCCGCTTATTTCTCGAGAAATAAGCGGCTCAAGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004051
GPRASP2 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor associated sorting protein 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000062873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004051.1-3430s1c1
Sequence:CCGGGCTGTCCAGATTGCGGTATTTCTCGAGAAATACCGCAATCTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004051.1-2035s21c1
Sequence:CCGGTCTGAAGAAGAGGCCATATTTCTCGAGAAATATGGCCTCTTCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004051.1-1021s21c1
Sequence:CCGGGTAGGTGGCGCTCGTTCTAAACTCGAGTTTAGAACGAGCGCCACCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004051.1-3116s21c1
Sequence:CCGGTCAGTCTTGAGCCGCTTATTTCTCGAGAAATAAGCGGCTCAAGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001474790
GPRASP2 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor associated sorting protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-1736s21c1
Sequence:CCGGTCCAAACAAGATCCCTATATTCTCGAGAATATAGGGATCTTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-3074s21c1
Sequence:CCGGTCTGGGTTTCTCGCCTTATTACTCGAGTAATAAGGCGAGAAACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001474790.1-3509s21c1
Sequence:CCGGTTCTGTGTCGTAACTTATATTCTCGAGAATATAAGTTACGACACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-1973s21c1
Sequence:CCGGGACAAGGAAGAGCCTAATAAGCTCGAGCTTATTAGGCTCTTCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-1190s21c1
Sequence:CCGGCCGAGATCTGAGGCTCAATTACTCGAGTAATTGAGCCTCAGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001474790
GPRASP2 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor associated sorting protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-1736s21c1
Sequence:CCGGTCCAAACAAGATCCCTATATTCTCGAGAATATAGGGATCTTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-3074s21c1
Sequence:CCGGTCTGGGTTTCTCGCCTTATTACTCGAGTAATAAGGCGAGAAACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001474790.1-3509s21c1
Sequence:CCGGTTCTGTGTCGTAACTTATATTCTCGAGAATATAAGTTACGACACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-1973s21c1
Sequence:CCGGGACAAGGAAGAGCCTAATAAGCTCGAGCTTATTAGGCTCTTCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-1190s21c1
Sequence:CCGGCCGAGATCTGAGGCTCAATTACTCGAGTAATTGAGCCTCAGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001474790
GPRASP2 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor associated sorting protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-1736s21c1
Sequence:CCGGTCCAAACAAGATCCCTATATTCTCGAGAATATAGGGATCTTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-3074s21c1
Sequence:CCGGTCTGGGTTTCTCGCCTTATTACTCGAGTAATAAGGCGAGAAACCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001474790.1-3509s21c1
Sequence:CCGGTTCTGTGTCGTAACTTATATTCTCGAGAATATAAGTTACGACACAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-1973s21c1
Sequence:CCGGGACAAGGAAGAGCCTAATAAGCTCGAGCTTATTAGGCTCTTCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001474790.1-1190s21c1
Sequence:CCGGCCGAGATCTGAGGCTCAATTACTCGAGTAATTGAGCCTCAGATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks