EMAIL THIS PAGE TO A FRIEND

GPRC5A

G protein-coupled receptor, family C, group 5, member A

56 Gene Product Result for
Synonyms: GPCR5A RAI3 RAIG1
UniProtKB ID: Q8NFJ5, B3KV45, O95357
Gene ID:
Human(9052) Summary: This gene encodes a member of the type 3 G protein-coupling receptor family, characterized by the signature 7-transmembrane domain motif. The encoded protein may be involved in interaction between retinoid acid and G protein signalling pathways. Retinoic acid plays a critical role in development, cellular growth, and differentiation. This gene may play a role in embryonic development and epithelial cell differentiation. [provided by RefSeq, Jul 2008]
Mouse(232431) G protein-coupled receptor, family C, group 5, member A
Rat(312790) G protein-coupled receptor, family C, group 5, member A
domestic guinea pig(100730088) G protein-coupled receptor, family C, group 5, member A
naked mole-rat(101697227) G protein-coupled receptor, family C, group 5, member A
sheep(101110748) G protein-coupled receptor, family C, group 5, member A
chicken(417960) G protein-coupled receptor, family C, group 5, member A
domestic cat(101093366) G protein-coupled receptor, family C, group 5, member A
cow(516026) G protein-coupled receptor, family C, group 5, member A
dog(486680) G protein-coupled receptor, family C, group 5, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003979 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015711 MISSION® esiRNA esiRNA targeting human GPRC5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003979 siRNAs that have been validated in the lab human pricing
NM_001079890 Rosetta Predictions rat pricing
NM_181444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003979 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050692 validated 1542
2 SASI_Hs01_00050693 predicted 1391
3 SASI_Hs01_00050694 predicted 1680
4 SASI_Hs01_00050695 predicted 1543
5 SASI_Hs01_00050696 predicted 1290
6 SASI_Hs01_00050697 predicted 1473
7 SASI_Hs02_00336671 predicted 1543
8 SASI_Hs01_00050699 predicted 1079
9 SASI_Hs01_00050700 predicted 1279
10 SASI_Hs01_00050701 predicted 1186
11 SASI_Hs01_00050698 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208209 predicted 1270
2 SASI_Rn02_00208210 predicted 831
3 SASI_Rn02_00208211 predicted 939
4 SASI_Rn02_00208212 predicted 952
5 SASI_Rn02_00208213 predicted 1269
6 SASI_Rn02_00208214 predicted 751
7 SASI_Rn02_00208215 predicted 566
8 SASI_Rn02_00208216 predicted 634
9 SASI_Rn02_00208217 predicted 847
10 SASI_Rn02_00208218 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349786 predicted 411
2 SASI_Mm01_00168011 predicted 950
3 SASI_Mm01_00168012 predicted 471
4 SASI_Mm01_00168013 predicted 651
5 SASI_Mm01_00168014 predicted 1072
6 SASI_Mm01_00168015 predicted 952
7 SASI_Mm01_00168016 predicted 1180
8 SASI_Mm01_00168018 predicted 1034
9 SASI_Mm01_00168019 predicted 753
10 SASI_Mm01_00168020 predicted 675
11 SASI_Mm01_00168017 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181444
VALIDATED
GPRC5A MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor, family C, group 5, member A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181444.5-1156s21c1
Sequence:CCGGGTCCGTACAATGACTACGAAGCTCGAGCTTCGTAGTCATTGTACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181444.5-1181s21c1
Sequence:CCGGCAAAGGCGACAGCTAACTGTTCTCGAGAACAGTTAGCTGTCGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181444.5-474s21c1
Sequence:CCGGCACGCTTTCAACTTGATCAAGCTCGAGCTTGATCAAGTTGAAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181444.3-1103s1c1
Sequence:CCGGTGCACCTTATTCCACCCATTTCTCGAGAAATGGGTGGAATAAGGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181444.3-285s1c1
Sequence:CCGGGCTTGCATGTTTGCACTCGTTCTCGAGAACGAGTGCAAACATGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181444.3-695s1c1
Sequence:CCGGCCTCATTTACGTGCTCGTCTTCTCGAGAAGACGAGCACGTAAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181444.3-195s1c1
Sequence:CCGGGATTCCAGGTACCACAGACTTCTCGAGAAGTCTGTGGTACCTGGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181444.3-975s1c1
Sequence:CCGGCCCACTGATTACCCAGTTGAACTCGAGTTCAACTGGGTAATCAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181444
VALIDATED
GPRC5A MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor, family C, group 5, member A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181444.5-1156s21c1
Sequence:CCGGGTCCGTACAATGACTACGAAGCTCGAGCTTCGTAGTCATTGTACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181444.5-1181s21c1
Sequence:CCGGCAAAGGCGACAGCTAACTGTTCTCGAGAACAGTTAGCTGTCGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181444.5-474s21c1
Sequence:CCGGCACGCTTTCAACTTGATCAAGCTCGAGCTTGATCAAGTTGAAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181444.3-1103s1c1
Sequence:CCGGTGCACCTTATTCCACCCATTTCTCGAGAAATGGGTGGAATAAGGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181444.3-285s1c1
Sequence:CCGGGCTTGCATGTTTGCACTCGTTCTCGAGAACGAGTGCAAACATGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181444.3-695s1c1
Sequence:CCGGCCTCATTTACGTGCTCGTCTTCTCGAGAAGACGAGCACGTAAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181444.3-195s1c1
Sequence:CCGGGATTCCAGGTACCACAGACTTCTCGAGAAGTCTGTGGTACCTGGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181444.3-975s1c1
Sequence:CCGGCCCACTGATTACCCAGTTGAACTCGAGTTCAACTGGGTAATCAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181444
VALIDATED
GPRC5A MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor, family C, group 5, member A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181444.5-1156s21c1
Sequence:CCGGGTCCGTACAATGACTACGAAGCTCGAGCTTCGTAGTCATTGTACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181444.5-1181s21c1
Sequence:CCGGCAAAGGCGACAGCTAACTGTTCTCGAGAACAGTTAGCTGTCGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181444.5-474s21c1
Sequence:CCGGCACGCTTTCAACTTGATCAAGCTCGAGCTTGATCAAGTTGAAAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181444.3-1103s1c1
Sequence:CCGGTGCACCTTATTCCACCCATTTCTCGAGAAATGGGTGGAATAAGGTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181444.3-285s1c1
Sequence:CCGGGCTTGCATGTTTGCACTCGTTCTCGAGAACGAGTGCAAACATGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181444.3-695s1c1
Sequence:CCGGCCTCATTTACGTGCTCGTCTTCTCGAGAAGACGAGCACGTAAATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181444.3-195s1c1
Sequence:CCGGGATTCCAGGTACCACAGACTTCTCGAGAAGTCTGTGGTACCTGGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181444.3-975s1c1
Sequence:CCGGCCCACTGATTACCCAGTTGAACTCGAGTTCAACTGGGTAATCAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003979
VALIDATED
GPRC5A MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor, family C, group 5, member A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-1112s21c1
Sequence:CCGGCCTGACCATGAATAGGACCAACTCGAGTTGGTCCTATTCATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-2175s21c1
Sequence:CCGGGCCCTTAATCTTGCTGTTATTCTCGAGAATAACAGCAAGATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-1425s21c1
Sequence:CCGGGCTTATGTTAGTCCCGAGTTTCTCGAGAAACTCGGGACTAACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-842s21c1
Sequence:CCGGGCTGCCTACTCAGTTTCTCTTCTCGAGAAGAGAAACTGAGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-1778s1c1
Sequence:CCGGGCCCTTAATCTTGCTGTTATTCTCGAGAATAACAGCAAGATTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-715s1c1
Sequence:CCGGCCTGACCATGAATAGGACCAACTCGAGTTGGTCCTATTCATGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-1028s1c1
Sequence:CCGGGCTTATGTTAGTCCCGAGTTTCTCGAGAAACTCGGGACTAACATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-445s1c1
Sequence:CCGGGCTGCCTACTCAGTTTCTCTTCTCGAGAAGAGAAACTGAGTAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-1289s1c1
Sequence:CCGGCCTTACAAAGACTATGAAGTACTCGAGTACTTCATAGTCTTTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003979
VALIDATED
GPRC5A MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor, family C, group 5, member A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-1112s21c1
Sequence:CCGGCCTGACCATGAATAGGACCAACTCGAGTTGGTCCTATTCATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-2175s21c1
Sequence:CCGGGCCCTTAATCTTGCTGTTATTCTCGAGAATAACAGCAAGATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-1425s21c1
Sequence:CCGGGCTTATGTTAGTCCCGAGTTTCTCGAGAAACTCGGGACTAACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-842s21c1
Sequence:CCGGGCTGCCTACTCAGTTTCTCTTCTCGAGAAGAGAAACTGAGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-1778s1c1
Sequence:CCGGGCCCTTAATCTTGCTGTTATTCTCGAGAATAACAGCAAGATTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-715s1c1
Sequence:CCGGCCTGACCATGAATAGGACCAACTCGAGTTGGTCCTATTCATGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-1028s1c1
Sequence:CCGGGCTTATGTTAGTCCCGAGTTTCTCGAGAAACTCGGGACTAACATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-445s1c1
Sequence:CCGGGCTGCCTACTCAGTTTCTCTTCTCGAGAAGAGAAACTGAGTAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-1289s1c1
Sequence:CCGGCCTTACAAAGACTATGAAGTACTCGAGTACTTCATAGTCTTTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003979
VALIDATED
GPRC5A MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor, family C, group 5, member A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-1112s21c1
Sequence:CCGGCCTGACCATGAATAGGACCAACTCGAGTTGGTCCTATTCATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-2175s21c1
Sequence:CCGGGCCCTTAATCTTGCTGTTATTCTCGAGAATAACAGCAAGATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-1425s21c1
Sequence:CCGGGCTTATGTTAGTCCCGAGTTTCTCGAGAAACTCGGGACTAACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003979.3-842s21c1
Sequence:CCGGGCTGCCTACTCAGTTTCTCTTCTCGAGAAGAGAAACTGAGTAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-1778s1c1
Sequence:CCGGGCCCTTAATCTTGCTGTTATTCTCGAGAATAACAGCAAGATTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-715s1c1
Sequence:CCGGCCTGACCATGAATAGGACCAACTCGAGTTGGTCCTATTCATGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-1028s1c1
Sequence:CCGGGCTTATGTTAGTCCCGAGTTTCTCGAGAAACTCGGGACTAACATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-445s1c1
Sequence:CCGGGCTGCCTACTCAGTTTCTCTTCTCGAGAAGAGAAACTGAGTAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003979.2-1289s1c1
Sequence:CCGGCCTTACAAAGACTATGAAGTACTCGAGTACTTCATAGTCTTTGTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks