EMAIL THIS PAGE TO A FRIEND

GPRC5B

G protein-coupled receptor, family C, group 5, member B

94 Gene Product Result for
Synonyms: RAIG-2 RAIG2
UniProtKB ID: Q9NZH0, D2DFB0, O75205, Q8NBZ8
Gene ID:
Human(51704) Summary: The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. [provided by RefSeq, Jul 2008]
Mouse(64297) G protein-coupled receptor, family C, group 5, member B
Rat(293546) G protein-coupled receptor, family C, group 5, member B
chicken(770648) G protein-coupled receptor, family C, group 5, member B
cow(516334) G protein-coupled receptor, family C, group 5, member B
chicken(101747453) G protein-coupled receptor, family C, group 5, member B
domestic cat(101093231) G protein-coupled receptor, family C, group 5, member B
dog(479823) G protein-coupled receptor, family C, group 5, member B
chicken(101665530) G protein-coupled receptor, family C, group 5, member B
sheep(101112533) G protein-coupled receptor, family C, group 5, member B
domestic guinea pig(100731063) G protein-coupled receptor, family C, group 5, member B
naked mole-rat(101703515) G protein-coupled receptor, family C, group 5, member B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016235 Rosetta Predictions human pricing
NM_001106304 Rosetta Predictions rat pricing
NM_022420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171699 predicted 1211
2 SASI_Hs01_00171700 predicted 855
3 SASI_Hs02_00349108 predicted 1370
4 SASI_Hs01_00171701 predicted 1431
5 SASI_Hs01_00171702 predicted 414
6 SASI_Hs01_00171703 predicted 1225
7 SASI_Hs01_00171705 predicted 693
8 SASI_Hs01_00171706 predicted 1336
9 SASI_Hs01_00171707 predicted 1242
10 SASI_Hs02_00349109 predicted 811
11 SASI_Hs01_00171704 predicted 1566
12 SASI_Hs01_00171708 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217658 predicted 1560
2 SASI_Rn02_00217659 predicted 452
3 SASI_Rn02_00217660 predicted 1581
4 SASI_Rn02_00217661 predicted 1056
5 SASI_Rn02_00217662 predicted 1441
6 SASI_Rn02_00217663 predicted 1343
7 SASI_Rn02_00217664 predicted 895
8 SASI_Rn02_00217665 predicted 1277
9 SASI_Rn02_00217666 predicted 1094
10 SASI_Rn02_00217667 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052017 predicted 1038
2 SASI_Mm01_00052018 predicted 1519
3 SASI_Mm01_00052019 predicted 1408
4 SASI_Mm01_00052020 predicted 1587
5 SASI_Mm01_00052021 predicted 1357
6 SASI_Mm01_00052022 predicted 1604
7 SASI_Mm01_00052023 predicted 1376
8 SASI_Mm01_00052024 predicted 436
9 SASI_Mm01_00052026 predicted 1346
10 SASI_Mm02_00326594 predicted 1354
11 SASI_Mm01_00052025 predicted 1603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016235
GPRC5B MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor, family C, group 5, member B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016235.1-1566s1c1
Sequence:CCGGCGCAAACTAAAGCAAAGCTAACTCGAGTTAGCTTTGCTTTAGTTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-862s1c1
Sequence:CCGGACCATGTACCTCTTCGGCAATCTCGAGATTGCCGAAGAGGTACATGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-715s1c1
Sequence:CCGGGCCCTCATCTACGACATGGTACTCGAGTACCATGTCGTAGATGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-432s1c1
Sequence:CCGGGCTGACGTTTGCCTTCATCATCTCGAGATGATGAAGGCAAACGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-1216s1c1
Sequence:CCGGCCGTTTAGAAGCAACGTGTATCTCGAGATACACGTTGCTTCTAAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016235.1-1310s21c1
Sequence:CCGGACCTTTGGTGAAAGACTTTAACTCGAGTTAAAGTCTTTCACCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016235.1-1344s21c1
Sequence:CCGGAGAATTTCTCTTACCGATTTGCTCGAGCAAATCGGTAAGAGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016235.1-1217s21c1
Sequence:CCGGCGTTTAGAAGCAACGTGTATCCTCGAGGATACACGTTGCTTCTAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016235.1-1768s21c1
Sequence:CCGGACCGTTGCGTTGAGGACAAATCTCGAGATTTGTCCTCAACGCAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016235
GPRC5B MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor, family C, group 5, member B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016235.1-1566s1c1
Sequence:CCGGCGCAAACTAAAGCAAAGCTAACTCGAGTTAGCTTTGCTTTAGTTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-862s1c1
Sequence:CCGGACCATGTACCTCTTCGGCAATCTCGAGATTGCCGAAGAGGTACATGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-715s1c1
Sequence:CCGGGCCCTCATCTACGACATGGTACTCGAGTACCATGTCGTAGATGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-432s1c1
Sequence:CCGGGCTGACGTTTGCCTTCATCATCTCGAGATGATGAAGGCAAACGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-1216s1c1
Sequence:CCGGCCGTTTAGAAGCAACGTGTATCTCGAGATACACGTTGCTTCTAAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016235.1-1310s21c1
Sequence:CCGGACCTTTGGTGAAAGACTTTAACTCGAGTTAAAGTCTTTCACCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016235.1-1344s21c1
Sequence:CCGGAGAATTTCTCTTACCGATTTGCTCGAGCAAATCGGTAAGAGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016235.1-1217s21c1
Sequence:CCGGCGTTTAGAAGCAACGTGTATCCTCGAGGATACACGTTGCTTCTAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016235.1-1768s21c1
Sequence:CCGGACCGTTGCGTTGAGGACAAATCTCGAGATTTGTCCTCAACGCAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016235
GPRC5B MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor, family C, group 5, member B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016235.1-1566s1c1
Sequence:CCGGCGCAAACTAAAGCAAAGCTAACTCGAGTTAGCTTTGCTTTAGTTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-862s1c1
Sequence:CCGGACCATGTACCTCTTCGGCAATCTCGAGATTGCCGAAGAGGTACATGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-715s1c1
Sequence:CCGGGCCCTCATCTACGACATGGTACTCGAGTACCATGTCGTAGATGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-432s1c1
Sequence:CCGGGCTGACGTTTGCCTTCATCATCTCGAGATGATGAAGGCAAACGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016235.1-1216s1c1
Sequence:CCGGCCGTTTAGAAGCAACGTGTATCTCGAGATACACGTTGCTTCTAAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016235.1-1310s21c1
Sequence:CCGGACCTTTGGTGAAAGACTTTAACTCGAGTTAAAGTCTTTCACCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378296    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016235.1-1344s21c1
Sequence:CCGGAGAATTTCTCTTACCGATTTGCTCGAGCAAATCGGTAAGAGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016235.1-1217s21c1
Sequence:CCGGCGTTTAGAAGCAACGTGTATCCTCGAGGATACACGTTGCTTCTAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016235.1-1768s21c1
Sequence:CCGGACCGTTGCGTTGAGGACAAATCTCGAGATTTGTCCTCAACGCAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022420
VALIDATED
GPRC5B MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor, family C, group 5, member B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022420.1-1128s1c1
Sequence:CCGGGCCTTCTCAATGGATGAACATCTCGAGATGTTCATCCATTGAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022420.1-3886s1c1
Sequence:CCGGGCCACCATATTGGGACTATAACTCGAGTTATAGTCCCAATATGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022420.1-1254s1c1
Sequence:CCGGCCGTTCAGAAGCAATGTGTATCTCGAGATACACATTGCTTCTGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022420.1-369s1c1
Sequence:CCGGCCCTTCATCAAGGACAAGGAACTCGAGTTCCTTGTCCTTGATGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022420.1-449s1c1
Sequence:CCGGCCTGACGTTTGCCTTCATCATCTCGAGATGATGAAGGCAAACGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022420.2-1397s21c1
Sequence:CCGGCCATTGGTGAAAGACCTTAAGCTCGAGCTTAAGGTCTTTCACCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022420.2-1463s21c1
Sequence:CCGGTGTCTTTCTTGAGGGCGAAATCTCGAGATTTCGCCCTCAAGAAAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022420.2-1752s21c1
Sequence:CCGGCAGACTATCTTGGCTTATTATCTCGAGATAATAAGCCAAGATAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022420
VALIDATED
GPRC5B MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor, family C, group 5, member B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022420.1-1128s1c1
Sequence:CCGGGCCTTCTCAATGGATGAACATCTCGAGATGTTCATCCATTGAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022420.1-3886s1c1
Sequence:CCGGGCCACCATATTGGGACTATAACTCGAGTTATAGTCCCAATATGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022420.1-1254s1c1
Sequence:CCGGCCGTTCAGAAGCAATGTGTATCTCGAGATACACATTGCTTCTGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022420.1-369s1c1
Sequence:CCGGCCCTTCATCAAGGACAAGGAACTCGAGTTCCTTGTCCTTGATGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022420.1-449s1c1
Sequence:CCGGCCTGACGTTTGCCTTCATCATCTCGAGATGATGAAGGCAAACGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022420.2-1397s21c1
Sequence:CCGGCCATTGGTGAAAGACCTTAAGCTCGAGCTTAAGGTCTTTCACCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022420.2-1463s21c1
Sequence:CCGGTGTCTTTCTTGAGGGCGAAATCTCGAGATTTCGCCCTCAAGAAAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022420.2-1752s21c1
Sequence:CCGGCAGACTATCTTGGCTTATTATCTCGAGATAATAAGCCAAGATAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022420
VALIDATED
GPRC5B MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor, family C, group 5, member B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_022420.1-1128s1c1
Sequence:CCGGGCCTTCTCAATGGATGAACATCTCGAGATGTTCATCCATTGAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022420.1-3886s1c1
Sequence:CCGGGCCACCATATTGGGACTATAACTCGAGTTATAGTCCCAATATGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022420.1-1254s1c1
Sequence:CCGGCCGTTCAGAAGCAATGTGTATCTCGAGATACACATTGCTTCTGAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022420.1-369s1c1
Sequence:CCGGCCCTTCATCAAGGACAAGGAACTCGAGTTCCTTGTCCTTGATGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022420.1-449s1c1
Sequence:CCGGCCTGACGTTTGCCTTCATCATCTCGAGATGATGAAGGCAAACGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022420.2-1397s21c1
Sequence:CCGGCCATTGGTGAAAGACCTTAAGCTCGAGCTTAAGGTCTTTCACCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022420.2-1463s21c1
Sequence:CCGGTGTCTTTCTTGAGGGCGAAATCTCGAGATTTCGCCCTCAAGAAAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413160    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022420.2-1752s21c1
Sequence:CCGGCAGACTATCTTGGCTTATTATCTCGAGATAATAAGCCAAGATAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)