EMAIL THIS PAGE TO A FRIEND

GPRC5C

G protein-coupled receptor, family C, group 5, member C

211 Gene Product Result for
Synonyms: RAIG-3 RAIG3
UniProtKB ID: Q9NQ84, B5BUN4, Q2NL85, Q9NZG5
Gene ID:
Human(55890) Summary: The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(70355) G protein-coupled receptor, family C, group 5, member C
Rat(287805) G protein-coupled receptor, family C, group 5, member C
Zebrafish(563405) G protein-coupled receptor, family C, group 5, member C
dog(483288) G protein-coupled receptor, family C, group 5, member C
domestic cat(101088442) G protein-coupled receptor, family C, group 5, member C
cow(535664) G protein-coupled receptor, family C, group 5, member C
Horse(100060724) G protein-coupled receptor, family C, group 5, member C
chicken(427814) G protein-coupled receptor, family C, group 5, member C
domestic guinea pig(100724731) G protein-coupled receptor, family C, group 5, member C
naked mole-rat(101722955) G protein-coupled receptor, family C, group 5, member C
sheep(101105426) G protein-coupled receptor, family C, group 5, member C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022036 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_147217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_147217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_147217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157441 MISSION® esiRNA esiRNA human GPRC5C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018653 Rosetta Predictions human pricing
NM_022036 Rosetta Predictions human pricing
XM_001081657 Rosetta Predictions rat pricing
XM_001081659 Rosetta Predictions rat pricing
XM_001081661 Rosetta Predictions rat pricing
XM_001081662 Rosetta Predictions rat pricing
XM_001081664 Rosetta Predictions rat pricing
XM_213518 Rosetta Predictions rat pricing
NM_001110337 Rosetta Predictions mouse pricing
NM_001110338 Rosetta Predictions mouse pricing
NM_147217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352154 predicted 1286
2 SASI_Hs01_00177697 predicted 1203
3 SASI_Hs01_00177698 predicted 384
4 SASI_Hs01_00177699 predicted 789
5 SASI_Hs01_00177700 predicted 1211
6 SASI_Hs01_00177701 predicted 1370
7 SASI_Hs01_00177702 predicted 856
8 SASI_Hs01_00177703 predicted 786
9 SASI_Hs02_00352155 predicted 387
10 SASI_Hs01_00177705 predicted 1003
11 SASI_Hs01_00177704 predicted 1206
12 SASI_Hs01_00177706 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355382 predicted 1832
2 SASI_Hs01_00111208 predicted 1759
3 SASI_Hs01_00111209 predicted 936
4 SASI_Hs01_00111210 predicted 1339
5 SASI_Hs01_00111211 predicted 1761
6 SASI_Hs01_00111212 predicted 1925
7 SASI_Hs01_00111213 predicted 1416
8 SASI_Hs01_00111214 predicted 1338
9 SASI_Hs02_00355383 predicted 938
10 SASI_Hs01_00111216 predicted 1553
11 SASI_Hs01_00111215 predicted 1766
12 SASI_Hs01_00111217 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372862 predicted 805
2 SASI_Rn02_00372863 predicted 332
3 SASI_Rn02_00372864 predicted 1401
4 SASI_Rn02_00372865 predicted 902
5 SASI_Rn02_00372866 predicted 889
6 SASI_Rn02_00372867 predicted 808
7 SASI_Rn02_00372868 predicted 293
8 SASI_Rn02_00372869 predicted 328
9 SASI_Rn02_00372870 predicted 329
10 SASI_Rn02_00372871 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372872 predicted 964
2 SASI_Rn02_00372873 predicted 495
3 SASI_Rn02_00372874 predicted 1068
4 SASI_Rn02_00372875 predicted 1047
5 SASI_Rn02_00372876 predicted 1543
6 SASI_Rn02_00372877 predicted 463
7 SASI_Rn02_00372878 predicted 1781
8 SASI_Rn02_00372879 predicted 1719
9 SASI_Rn02_00372880 predicted 1049
10 SASI_Rn02_00372881 predicted 1792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372882 predicted 968
2 SASI_Rn02_00372883 predicted 492
3 SASI_Rn02_00372884 predicted 1568
4 SASI_Rn02_00372885 predicted 1062
5 SASI_Rn02_00372886 predicted 1049
6 SASI_Rn02_00372887 predicted 969
7 SASI_Rn02_00372888 predicted 457
8 SASI_Rn02_00372889 predicted 493
9 SASI_Rn02_00372890 predicted 496
10 SASI_Rn02_00372891 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372892 predicted 1349
2 SASI_Rn02_00372893 predicted 880
3 SASI_Rn02_00372894 predicted 1948
4 SASI_Rn02_00372895 predicted 1442
5 SASI_Rn02_00372896 predicted 1433
6 SASI_Rn02_00372897 predicted 1350
7 SASI_Rn02_00372898 predicted 842
8 SASI_Rn02_00372899 predicted 872
9 SASI_Rn02_00372900 predicted 871
10 SASI_Rn02_00372901 predicted 1937
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372902 predicted 957
2 SASI_Rn02_00372903 predicted 489
3 SASI_Rn02_00372904 predicted 1558
4 SASI_Rn02_00372905 predicted 1059
5 SASI_Rn02_00372906 predicted 1048
6 SASI_Rn02_00372907 predicted 967
7 SASI_Rn02_00372908 predicted 450
8 SASI_Rn02_00372909 predicted 483
9 SASI_Rn02_00372910 predicted 491
10 SASI_Rn02_00372911 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374686 predicted 1354
2 SASI_Rn02_00374687 predicted 875
3 SASI_Rn02_00374688 predicted 1947
4 SASI_Rn02_00374689 predicted 1441
5 SASI_Rn02_00374690 predicted 1434
6 SASI_Rn02_00374691 predicted 1349
7 SASI_Rn02_00374692 predicted 839
8 SASI_Rn02_00374693 predicted 870
9 SASI_Rn02_00374694 predicted 875
10 SASI_Rn02_00374695 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305478 predicted 562
2 SASI_Mm02_00305479 predicted 785
3 SASI_Mm02_00305480 predicted 589
4 SASI_Mm02_00305481 predicted 1252
5 SASI_Mm02_00305482 predicted 1221
6 SASI_Mm02_00305483 predicted 693
7 SASI_Mm02_00305484 predicted 693
8 SASI_Mm02_00305485 predicted 992
9 SASI_Mm02_00305486 predicted 673
10 SASI_Mm02_00305487 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305488 predicted 468
2 SASI_Mm02_00305489 predicted 928
3 SASI_Mm02_00305490 predicted 902
4 SASI_Mm02_00305491 predicted 904
5 SASI_Mm02_00305492 predicted 936
6 SASI_Mm02_00305493 predicted 676
7 SASI_Mm02_00305494 predicted 578
8 SASI_Mm02_00305495 predicted 763
9 SASI_Mm02_00305496 predicted 927
10 SASI_Mm02_00305497 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00342694 predicted 675
2 SASI_Mm01_00069455 predicted 1139
3 SASI_Mm02_00342695 predicted 1106
4 SASI_Mm02_00342696 predicted 1115
5 SASI_Mm02_00342697 predicted 1143
6 SASI_Mm02_00342698 predicted 886
7 SASI_Mm01_00069457 predicted 792
8 SASI_Mm01_00069458 predicted 972
9 SASI_Mm02_00342699 predicted 1137
10 SASI_Mm02_00342700 predicted 771
11 SASI_Mm01_00069452 predicted 1530
12 SASI_Mm01_00069453 predicted 1363
13 SASI_Mm01_00069454 predicted 441
14 SASI_Mm01_00069456 predicted 563
15 SASI_Mm01_00069459 predicted 478
16 SASI_Mm01_00069460 predicted 271
17 SASI_Mm01_00069461 predicted 875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022036
GPRC5C MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor, family C, group 5, member C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022036.2-1713s21c1
Sequence:CCGGCACCATACAGCGGGTACAATGCTCGAGCATTGTACCCGCTGTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022036.2-1930s21c1
Sequence:CCGGCAAGAACTCTCAGGTCTTTAGCTCGAGCTAAAGACCTGAGAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022036.2-1794s21c1
Sequence:CCGGCCGAAGGAGCTTACGACATCACTCGAGTGATGTCGTAAGCTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022036.2-2210s21c1
Sequence:CCGGGGTCACACTCCAGCCAAATAGCTCGAGCTATTTGGCTGGAGTGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022036.2-2208s1c1
Sequence:CCGGGCGGTCACACTCCAGCCAAATCTCGAGATTTGGCTGGAGTGTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-1795s1c1
Sequence:CCGGCGAAGGAGCTTACGACATCATCTCGAGATGATGTCGTAAGCTCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-1426s1c1
Sequence:CCGGCGTCATGTATACTTACGGCAACTCGAGTTGCCGTAAGTATACATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-821s1c1
Sequence:CCGGGCGGGCATTGTCACCACGTTTCTCGAGAAACGTGGTGACAATGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-1929s1c1
Sequence:CCGGGCAAGAACTCTCAGGTCTTTACTCGAGTAAAGACCTGAGAGTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022036
GPRC5C MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor, family C, group 5, member C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022036.2-1713s21c1
Sequence:CCGGCACCATACAGCGGGTACAATGCTCGAGCATTGTACCCGCTGTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022036.2-1930s21c1
Sequence:CCGGCAAGAACTCTCAGGTCTTTAGCTCGAGCTAAAGACCTGAGAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022036.2-1794s21c1
Sequence:CCGGCCGAAGGAGCTTACGACATCACTCGAGTGATGTCGTAAGCTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022036.2-2210s21c1
Sequence:CCGGGGTCACACTCCAGCCAAATAGCTCGAGCTATTTGGCTGGAGTGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022036.2-2208s1c1
Sequence:CCGGGCGGTCACACTCCAGCCAAATCTCGAGATTTGGCTGGAGTGTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-1795s1c1
Sequence:CCGGCGAAGGAGCTTACGACATCATCTCGAGATGATGTCGTAAGCTCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-1426s1c1
Sequence:CCGGCGTCATGTATACTTACGGCAACTCGAGTTGCCGTAAGTATACATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-821s1c1
Sequence:CCGGGCGGGCATTGTCACCACGTTTCTCGAGAAACGTGGTGACAATGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-1929s1c1
Sequence:CCGGGCAAGAACTCTCAGGTCTTTACTCGAGTAAAGACCTGAGAGTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022036
GPRC5C MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor, family C, group 5, member C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022036.2-1713s21c1
Sequence:CCGGCACCATACAGCGGGTACAATGCTCGAGCATTGTACCCGCTGTATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022036.2-1930s21c1
Sequence:CCGGCAAGAACTCTCAGGTCTTTAGCTCGAGCTAAAGACCTGAGAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022036.2-1794s21c1
Sequence:CCGGCCGAAGGAGCTTACGACATCACTCGAGTGATGTCGTAAGCTCCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022036.2-2210s21c1
Sequence:CCGGGGTCACACTCCAGCCAAATAGCTCGAGCTATTTGGCTGGAGTGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008987    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022036.2-2208s1c1
Sequence:CCGGGCGGTCACACTCCAGCCAAATCTCGAGATTTGGCTGGAGTGTGACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-1795s1c1
Sequence:CCGGCGAAGGAGCTTACGACATCATCTCGAGATGATGTCGTAAGCTCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-1426s1c1
Sequence:CCGGCGTCATGTATACTTACGGCAACTCGAGTTGCCGTAAGTATACATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-821s1c1
Sequence:CCGGGCGGGCATTGTCACCACGTTTCTCGAGAAACGTGGTGACAATGCCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022036.2-1929s1c1
Sequence:CCGGGCAAGAACTCTCAGGTCTTTACTCGAGTAAAGACCTGAGAGTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147217
GPRC5C MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor, family C, group 5, member C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-1543s1c1
Sequence:CCGGTCAGGTCTTTAGAAATCCCTACTCGAGTAGGGATTTCTAAAGACCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-1015s1c1
Sequence:CCGGCTGGGTGGTATGGATTGTCATCTCGAGATGACAATCCATACCACCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-1120s1c1
Sequence:CCGGCTTTGTCCTCTTCTATGTCATCTCGAGATGACATAGAAGAGGACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-658s1c1
Sequence:CCGGTCACGTCCTTTCCCTCAACTTCTCGAGAAGTTGAGGGAAAGGACGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-425s1c1
Sequence:CCGGGCAGGCATCATCACGACATTTCTCGAGAAATGTCGTGATGATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147217
GPRC5C MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor, family C, group 5, member C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-1543s1c1
Sequence:CCGGTCAGGTCTTTAGAAATCCCTACTCGAGTAGGGATTTCTAAAGACCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-1015s1c1
Sequence:CCGGCTGGGTGGTATGGATTGTCATCTCGAGATGACAATCCATACCACCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-1120s1c1
Sequence:CCGGCTTTGTCCTCTTCTATGTCATCTCGAGATGACATAGAAGAGGACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-658s1c1
Sequence:CCGGTCACGTCCTTTCCCTCAACTTCTCGAGAAGTTGAGGGAAAGGACGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-425s1c1
Sequence:CCGGGCAGGCATCATCACGACATTTCTCGAGAAATGTCGTGATGATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147217
GPRC5C MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor, family C, group 5, member C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-1543s1c1
Sequence:CCGGTCAGGTCTTTAGAAATCCCTACTCGAGTAGGGATTTCTAAAGACCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-1015s1c1
Sequence:CCGGCTGGGTGGTATGGATTGTCATCTCGAGATGACAATCCATACCACCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-1120s1c1
Sequence:CCGGCTTTGTCCTCTTCTATGTCATCTCGAGATGACATAGAAGAGGACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-658s1c1
Sequence:CCGGTCACGTCCTTTCCCTCAACTTCTCGAGAAGTTGAGGGAAAGGACGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147217.1-425s1c1
Sequence:CCGGGCAGGCATCATCACGACATTTCTCGAGAAATGTCGTGATGATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks