EMAIL THIS PAGE TO A FRIEND

GPRC5D

G protein-coupled receptor, family C, group 5, member D

49 Gene Product Result for
UniProtKB ID: Q9NZD1, Q3KNV3, Q7Z5J9, Q8TDS6
Gene ID:
Human(55507) Summary: The protein encoded by this gene is a member of the G protein-coupled receptor family; however, the specific function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(93746) G protein-coupled receptor, family C, group 5, member D
Rat(500349) G protein-coupled receptor, family C, group 5, member D
sheep(101110492) G protein-coupled receptor, family C, group 5, member D
domestic guinea pig(100730362) G protein-coupled receptor, family C, group 5, member D
naked mole-rat(101696482) G protein-coupled receptor, family C, group 5, member D
dog(486679) G protein-coupled receptor, family C, group 5, member D
domestic cat(101082499) G protein-coupled receptor, family C, group 5, member D
cow(534963) G protein-coupled receptor, family C, group 5, member D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018654 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018654 Rosetta Predictions human pricing
NM_001109254 Rosetta Predictions rat pricing
NM_053118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049814 predicted 542
2 SASI_Hs01_00049816 predicted 595
3 SASI_Hs01_00049817 predicted 542
4 SASI_Hs01_00049818 predicted 734
5 SASI_Hs01_00049819 predicted 322
6 SASI_Hs01_00049820 predicted 312
7 SASI_Hs01_00049821 predicted 406
8 SASI_Hs01_00049822 predicted 320
9 SASI_Hs01_00049823 predicted 605
10 SASI_Hs02_00352156 predicted 229
11 SASI_Hs01_00049815 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246604 predicted 1130
2 SASI_Rn02_00246605 predicted 1069
3 SASI_Rn02_00246606 predicted 623
4 SASI_Rn02_00246607 predicted 1100
5 SASI_Rn02_00246608 predicted 794
6 SASI_Rn02_00246609 predicted 1089
7 SASI_Rn02_00246610 predicted 1150
8 SASI_Rn02_00246611 predicted 1049
9 SASI_Rn02_00246612 predicted 229
10 SASI_Rn02_00246613 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110195 predicted 1091
2 SASI_Mm01_00110196 predicted 765
3 SASI_Mm01_00110197 predicted 214
4 SASI_Mm01_00110198 predicted 238
5 SASI_Mm01_00110200 predicted 310
6 SASI_Mm02_00337627 predicted 603
7 SASI_Mm01_00110201 predicted 529
8 SASI_Mm01_00110203 predicted 1055
9 SASI_Mm01_00110204 predicted 1059
10 SASI_Mm02_00337628 predicted 714
11 SASI_Mm01_00110199 predicted 924
12 SASI_Mm01_00110202 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018654
GPRC5D MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor, family C, group 5, member D
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-235s1c1
Sequence:CCGGGCCTTCATCATCGAGCTCAATCTCGAGATTGAGCTCGATGATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-117s1c1
Sequence:CCGGGCTACTCTTAGCATTTCTCTTCTCGAGAAGAGAAATGCTAAGAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-493s1c1
Sequence:CCGGCAGCTCAATGTGGACTTTGTTCTCGAGAACAAAGTCCACATTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-788s1c1
Sequence:CCGGGCATTCTCTACAGATCGTGTACTCGAGTACACGATCTGTAGAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-409s21c1
Sequence:CCGGAGTCTGTTGCAAATCATTATTCTCGAGAATAATGATTTGCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-602s21c1
Sequence:CCGGAGCATGGAAGGCTCATCTTTACTCGAGTAAAGATGAGCCTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-367s21c1
Sequence:CCGGTCCTTCTCCTGGACGACAATTCTCGAGAATTGTCGTCCAGGAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-243s21c1
Sequence:CCGGCATCGAGCTCAATCAACAAACCTCGAGGTTTGTTGATTGAGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018654
GPRC5D MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor, family C, group 5, member D
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-235s1c1
Sequence:CCGGGCCTTCATCATCGAGCTCAATCTCGAGATTGAGCTCGATGATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-117s1c1
Sequence:CCGGGCTACTCTTAGCATTTCTCTTCTCGAGAAGAGAAATGCTAAGAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-493s1c1
Sequence:CCGGCAGCTCAATGTGGACTTTGTTCTCGAGAACAAAGTCCACATTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-788s1c1
Sequence:CCGGGCATTCTCTACAGATCGTGTACTCGAGTACACGATCTGTAGAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-409s21c1
Sequence:CCGGAGTCTGTTGCAAATCATTATTCTCGAGAATAATGATTTGCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-602s21c1
Sequence:CCGGAGCATGGAAGGCTCATCTTTACTCGAGTAAAGATGAGCCTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-367s21c1
Sequence:CCGGTCCTTCTCCTGGACGACAATTCTCGAGAATTGTCGTCCAGGAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-243s21c1
Sequence:CCGGCATCGAGCTCAATCAACAAACCTCGAGGTTTGTTGATTGAGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018654
GPRC5D MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor, family C, group 5, member D
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-235s1c1
Sequence:CCGGGCCTTCATCATCGAGCTCAATCTCGAGATTGAGCTCGATGATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-117s1c1
Sequence:CCGGGCTACTCTTAGCATTTCTCTTCTCGAGAAGAGAAATGCTAAGAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-493s1c1
Sequence:CCGGCAGCTCAATGTGGACTTTGTTCTCGAGAACAAAGTCCACATTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018654.1-788s1c1
Sequence:CCGGGCATTCTCTACAGATCGTGTACTCGAGTACACGATCTGTAGAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-409s21c1
Sequence:CCGGAGTCTGTTGCAAATCATTATTCTCGAGAATAATGATTTGCAACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-602s21c1
Sequence:CCGGAGCATGGAAGGCTCATCTTTACTCGAGTAAAGATGAGCCTTCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-367s21c1
Sequence:CCGGTCCTTCTCCTGGACGACAATTCTCGAGAATTGTCGTCCAGGAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018654.1-243s21c1
Sequence:CCGGCATCGAGCTCAATCAACAAACCTCGAGGTTTGTTGATTGAGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053118
GPRC5D MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor, family C, group 5, member D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-519s1c1
Sequence:CCGGCTGCTGGACAACAATTCTGTTCTCGAGAACAGAATTGTTGTCCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-257s1c1
Sequence:CCGGCCATATTGCTACTCCTGGCATCTCGAGATGCCAGGAGTAGCAATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-270s1c1
Sequence:CCGGCCTGGCATTTCTGTTCCTCATCTCGAGATGAGGAACAGAAATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-737s1c1
Sequence:CCGGAGAACTGGAAACAGCACGGAACTCGAGTTCCGTGCTGTTTCCAGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-935s1c1
Sequence:CCGGGCATACTCTACAGGTCATGTACTCGAGTACATGACCTGTAGAGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053118
GPRC5D MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor, family C, group 5, member D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-519s1c1
Sequence:CCGGCTGCTGGACAACAATTCTGTTCTCGAGAACAGAATTGTTGTCCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-257s1c1
Sequence:CCGGCCATATTGCTACTCCTGGCATCTCGAGATGCCAGGAGTAGCAATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-270s1c1
Sequence:CCGGCCTGGCATTTCTGTTCCTCATCTCGAGATGAGGAACAGAAATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-737s1c1
Sequence:CCGGAGAACTGGAAACAGCACGGAACTCGAGTTCCGTGCTGTTTCCAGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-935s1c1
Sequence:CCGGGCATACTCTACAGGTCATGTACTCGAGTACATGACCTGTAGAGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053118
GPRC5D MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor, family C, group 5, member D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-519s1c1
Sequence:CCGGCTGCTGGACAACAATTCTGTTCTCGAGAACAGAATTGTTGTCCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-257s1c1
Sequence:CCGGCCATATTGCTACTCCTGGCATCTCGAGATGCCAGGAGTAGCAATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-270s1c1
Sequence:CCGGCCTGGCATTTCTGTTCCTCATCTCGAGATGAGGAACAGAAATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-737s1c1
Sequence:CCGGAGAACTGGAAACAGCACGGAACTCGAGTTCCGTGCTGTTTCCAGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053118.1-935s1c1
Sequence:CCGGGCATACTCTACAGGTCATGTACTCGAGTACATGACCTGTAGAGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks