EMAIL THIS PAGE TO A FRIEND

GPRC6A

G protein-coupled receptor, family C, group 6, member A

59 Gene Product Result for
Synonyms: GPCR bA86F4.3
UniProtKB ID: Q5T6X5, Q6JK43, Q6JK44, Q8NGU8, Q8NHZ9, Q8TDT6
Gene ID:
Human(222545) Summary: Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]
Mouse(210198) G protein-coupled receptor, family C, group 6, member A
Rat(294394) G protein-coupled receptor, family C, group 6, member A
Zebrafish(494131) G protein-coupled receptor, family C, group 6, member A
chicken(428620) G protein-coupled receptor, family C, group 6, member A
domestic cat(101092611) G protein-coupled receptor, family C, group 6, member A
cow(783669) G protein-coupled receptor, family C, group 6, member A
Horse(100067090) G protein-coupled receptor, family C, group 6, member A
dog(484095) G protein-coupled receptor, family C, group 6, member A
domestic guinea pig(101789274) G protein-coupled receptor, family C, group 6, member A
naked mole-rat(101702476) G protein-coupled receptor, family C, group 6, member A
sheep(101104322) G protein-coupled receptor, family C, group 6, member A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306881 ANTI-GPRC6A (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4500879 Anti-GPRC6A antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148963 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138701 MISSION® esiRNA esiRNA human GPRC6A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148963 Rosetta Predictions human pricing
XM_001059232 Rosetta Predictions rat pricing
XM_228164 Rosetta Predictions rat pricing
NM_153071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218280 predicted 2480
2 SASI_Hs01_00218281 predicted 1097
3 SASI_Hs01_00218282 predicted 441
4 SASI_Hs02_00365680 predicted 827
5 SASI_Hs01_00218284 predicted 1339
6 SASI_Hs01_00218285 predicted 1868
7 SASI_Hs01_00218286 predicted 1144
8 SASI_Hs02_00365681 predicted 2081
9 SASI_Hs01_00218288 predicted 1212
10 SASI_Hs02_00365682 predicted 1764
11 SASI_Hs01_00218279 predicted 1200
12 SASI_Hs01_00218283 predicted 2425
13 SASI_Hs01_00218287 predicted 2383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292544 predicted 1544
2 SASI_Rn02_00292545 predicted 1535
3 SASI_Rn02_00292546 predicted 2211
4 SASI_Rn02_00292547 predicted 979
5 SASI_Rn02_00292548 predicted 252
6 SASI_Rn02_00292549 predicted 315
7 SASI_Rn02_00292550 predicted 494
8 SASI_Rn02_00292551 predicted 1123
9 SASI_Rn02_00292552 predicted 1591
10 SASI_Rn02_00292553 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384966 predicted 1546
2 SASI_Rn02_00384967 predicted 1533
3 SASI_Rn02_00384968 predicted 1544
4 SASI_Rn02_00384969 predicted 1595
5 SASI_Rn02_00384970 predicted 2388
6 SASI_Rn02_00384971 predicted 1772
7 SASI_Rn02_00384972 predicted 2466
8 SASI_Rn02_00384973 predicted 2376
9 SASI_Rn02_00384974 predicted 2563
10 SASI_Rn02_00384975 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129328 predicted 2011
2 SASI_Mm01_00129329 predicted 1595
3 SASI_Mm01_00129330 predicted 1908
4 SASI_Mm01_00129331 predicted 251
5 SASI_Mm01_00129332 predicted 497
6 SASI_Mm01_00129333 predicted 1098
7 SASI_Mm01_00129334 predicted 2396
8 SASI_Mm01_00129335 predicted 1327
9 SASI_Mm01_00129336 predicted 322
10 SASI_Mm02_00342896 predicted 1157
11 SASI_Mm01_00129327 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148963
GPRC6A MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor, family C, group 6, member A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148963.2-2420s21c1
Sequence:CCGGCCTATCTATGCTACCACATTTCTCGAGAAATGTGGTAGCATAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148963.2-109s21c1
Sequence:CCGGTGCCACTTCTCCGGGACATATCTCGAGATATGTCCCGGAGAAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148963.2-1844s21c1
Sequence:CCGGGTTCTGGTTGTTGGCATAATACTCGAGTATTATGCCAACAACCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-1247s1c1
Sequence:CCGGCCAGGACTCATTCATAGTATTCTCGAGAATACTATGAATGAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-194s1c1
Sequence:CCGGCCACAAATCCAGGAGTGTGTTCTCGAGAACACACTCCTGGATTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-719s1c1
Sequence:CCGGGAAGCAAATAACGTGTGCATACTCGAGTATGCACACGTTATTTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-2133s1c1
Sequence:CCGGCGATCCTTATTATCTTCACTTCTCGAGAAGTGAAGATAATAAGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-2456s1c1
Sequence:CCGGGCTGTGGAGATTATTGTCATACTCGAGTATGACAATAATCTCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148963
GPRC6A MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor, family C, group 6, member A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148963.2-2420s21c1
Sequence:CCGGCCTATCTATGCTACCACATTTCTCGAGAAATGTGGTAGCATAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148963.2-109s21c1
Sequence:CCGGTGCCACTTCTCCGGGACATATCTCGAGATATGTCCCGGAGAAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148963.2-1844s21c1
Sequence:CCGGGTTCTGGTTGTTGGCATAATACTCGAGTATTATGCCAACAACCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-1247s1c1
Sequence:CCGGCCAGGACTCATTCATAGTATTCTCGAGAATACTATGAATGAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-194s1c1
Sequence:CCGGCCACAAATCCAGGAGTGTGTTCTCGAGAACACACTCCTGGATTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-719s1c1
Sequence:CCGGGAAGCAAATAACGTGTGCATACTCGAGTATGCACACGTTATTTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-2133s1c1
Sequence:CCGGCGATCCTTATTATCTTCACTTCTCGAGAAGTGAAGATAATAAGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-2456s1c1
Sequence:CCGGGCTGTGGAGATTATTGTCATACTCGAGTATGACAATAATCTCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148963
GPRC6A MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor, family C, group 6, member A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148963.2-2420s21c1
Sequence:CCGGCCTATCTATGCTACCACATTTCTCGAGAAATGTGGTAGCATAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148963.2-109s21c1
Sequence:CCGGTGCCACTTCTCCGGGACATATCTCGAGATATGTCCCGGAGAAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148963.2-1844s21c1
Sequence:CCGGGTTCTGGTTGTTGGCATAATACTCGAGTATTATGCCAACAACCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-1247s1c1
Sequence:CCGGCCAGGACTCATTCATAGTATTCTCGAGAATACTATGAATGAGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-194s1c1
Sequence:CCGGCCACAAATCCAGGAGTGTGTTCTCGAGAACACACTCCTGGATTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-719s1c1
Sequence:CCGGGAAGCAAATAACGTGTGCATACTCGAGTATGCACACGTTATTTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-2133s1c1
Sequence:CCGGCGATCCTTATTATCTTCACTTCTCGAGAAGTGAAGATAATAAGGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148963.1-2456s1c1
Sequence:CCGGGCTGTGGAGATTATTGTCATACTCGAGTATGACAATAATCTCCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153071
GPRC6A MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor, family C, group 6, member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-1896s1c1
Sequence:CCGGCGTGAAATCATCTGGAGGATTCTCGAGAATCCTCCAGATGATTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-1252s1c1
Sequence:CCGGCCGGGACTCATTTATAGCATTCTCGAGAATGCTATAAATGAGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-763s1c1
Sequence:CCGGCCAGCCTTCCTCTCAGATAATCTCGAGATTATCTGAGAGGAAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-2467s1c1
Sequence:CCGGGCCGTGGAGATTATAGTCATTCTCGAGAATGACTATAATCTCCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-2430s1c1
Sequence:CCGGCCCTGTCTATACTACCACATTCTCGAGAATGTGGTAGTATAGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153071
GPRC6A MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor, family C, group 6, member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-1896s1c1
Sequence:CCGGCGTGAAATCATCTGGAGGATTCTCGAGAATCCTCCAGATGATTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-1252s1c1
Sequence:CCGGCCGGGACTCATTTATAGCATTCTCGAGAATGCTATAAATGAGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-763s1c1
Sequence:CCGGCCAGCCTTCCTCTCAGATAATCTCGAGATTATCTGAGAGGAAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-2467s1c1
Sequence:CCGGGCCGTGGAGATTATAGTCATTCTCGAGAATGACTATAATCTCCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-2430s1c1
Sequence:CCGGCCCTGTCTATACTACCACATTCTCGAGAATGTGGTAGTATAGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153071
GPRC6A MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor, family C, group 6, member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-1896s1c1
Sequence:CCGGCGTGAAATCATCTGGAGGATTCTCGAGAATCCTCCAGATGATTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-1252s1c1
Sequence:CCGGCCGGGACTCATTTATAGCATTCTCGAGAATGCTATAAATGAGTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-763s1c1
Sequence:CCGGCCAGCCTTCCTCTCAGATAATCTCGAGATTATCTGAGAGGAAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-2467s1c1
Sequence:CCGGGCCGTGGAGATTATAGTCATTCTCGAGAATGACTATAATCTCCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153071.1-2430s1c1
Sequence:CCGGCCCTGTCTATACTACCACATTCTCGAGAATGTGGTAGTATAGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks