EMAIL THIS PAGE TO A FRIEND

GPRIN1

G protein regulated inducer of neurite outgrowth 1

110 Gene Product Result for
Synonyms: GRIN1
UniProtKB ID: Q7Z2K8, C9JM70, Q8ND74, Q96PZ4
Gene ID:
Mouse(26913) G protein-regulated inducer of neurite outgrowth 1
Rat(364676) G protein-regulated inducer of neurite outgrowth 1
chicken(427634) G protein regulated inducer of neurite outgrowth 1
chicken(101665300) G protein regulated inducer of neurite outgrowth 1
cow(517383) G protein regulated inducer of neurite outgrowth 1
Horse(100068792) G protein regulated inducer of neurite outgrowth 1
domestic cat(101088390) G protein regulated inducer of neurite outgrowth 1
dog(489100) G protein regulated inducer of neurite outgrowth 1
chicken(101748622) G protein regulated inducer of neurite outgrowth 1
sheep(101105750) G protein regulated inducer of neurite outgrowth 1
domestic guinea pig(100724312) G protein regulated inducer of neurite outgrowth 1
naked mole-rat(101709196) G protein regulated inducer of neurite outgrowth 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052899 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052899 Rosetta Predictions human pricing
XM_001070221 Rosetta Predictions rat pricing
XM_344571 Rosetta Predictions rat pricing
NM_012014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058341 predicted 1372
2 SASI_Hs01_00058342 predicted 1961
3 SASI_Hs01_00058343 predicted 1565
4 SASI_Hs01_00058344 predicted 1640
5 SASI_Hs01_00058345 predicted 829
6 SASI_Hs01_00058346 predicted 1257
7 SASI_Hs01_00058347 predicted 654
8 SASI_Hs01_00058348 predicted 1013
9 SASI_Hs01_00058349 predicted 598
10 SASI_Hs02_00361635 predicted 1088
11 SASI_Hs01_00058350 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330854 predicted 554
2 SASI_Rn02_00330855 predicted 629
3 SASI_Rn02_00330856 predicted 265
4 SASI_Rn02_00330857 predicted 1124
5 SASI_Rn02_00330858 predicted 650
6 SASI_Rn02_00330859 predicted 380
7 SASI_Rn02_00330860 predicted 1672
8 SASI_Rn02_00330861 predicted 899
9 SASI_Rn02_00330862 predicted 1047
10 SASI_Rn02_00330863 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397270 predicted 563
2 SASI_Rn02_00397271 predicted 623
3 SASI_Rn02_00397272 predicted 268
4 SASI_Rn02_00397273 predicted 1124
5 SASI_Rn02_00397274 predicted 656
6 SASI_Rn02_00397275 predicted 378
7 SASI_Rn02_00397276 predicted 899
8 SASI_Rn02_00397277 predicted 1051
9 SASI_Rn02_00397278 predicted 333
10 SASI_Rn02_00397279 predicted 2865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141709 predicted 1139
2 SASI_Mm01_00141710 predicted 1350
3 SASI_Mm02_00321956 predicted 865
4 SASI_Mm01_00141711 predicted 574
5 SASI_Mm01_00141712 predicted 909
6 SASI_Mm01_00141713 predicted 1454
7 SASI_Mm01_00141714 predicted 971
8 SASI_Mm01_00141715 predicted 936
9 SASI_Mm01_00141716 predicted 2088
10 SASI_Mm01_00141718 predicted 1514
11 SASI_Mm01_00141717 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012014
GPRIN1 MISSION shRNA Bacterial Glycerol Stock
G protein regulated inducer of neurite outgrowth 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-818s1c1
Sequence:CCGGCGGACCCTGTTTCCTTAAGAACTCGAGTTCTTAAGGAAACAGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-536s1c1
Sequence:CCGGCAGAGCTTGTATCCTCAGTAACTCGAGTTACTGAGGATACAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-661s1c1
Sequence:CCGGCCTCAGTTGCTTGGAAAGAAACTCGAGTTTCTTTCCAAGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-310s1c1
Sequence:CCGGGCTGGGTCTTTAAGAAAGGTACTCGAGTACCTTTCTTAAAGACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012014.1-2673s1c1
Sequence:CCGGGCTTCTTTCAAGCCCTTCCTTCTCGAGAAGGAAGGGCTTGAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012014
GPRIN1 MISSION shRNA shRNA Plasmid DNA
G protein regulated inducer of neurite outgrowth 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-818s1c1
Sequence:CCGGCGGACCCTGTTTCCTTAAGAACTCGAGTTCTTAAGGAAACAGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-536s1c1
Sequence:CCGGCAGAGCTTGTATCCTCAGTAACTCGAGTTACTGAGGATACAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-661s1c1
Sequence:CCGGCCTCAGTTGCTTGGAAAGAAACTCGAGTTTCTTTCCAAGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-310s1c1
Sequence:CCGGGCTGGGTCTTTAAGAAAGGTACTCGAGTACCTTTCTTAAAGACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012014.1-2673s1c1
Sequence:CCGGGCTTCTTTCAAGCCCTTCCTTCTCGAGAAGGAAGGGCTTGAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012014
GPRIN1 MISSION shRNA Lentiviral Transduction Particles
G protein regulated inducer of neurite outgrowth 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-818s1c1
Sequence:CCGGCGGACCCTGTTTCCTTAAGAACTCGAGTTCTTAAGGAAACAGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-536s1c1
Sequence:CCGGCAGAGCTTGTATCCTCAGTAACTCGAGTTACTGAGGATACAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-661s1c1
Sequence:CCGGCCTCAGTTGCTTGGAAAGAAACTCGAGTTTCTTTCCAAGCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012014.1-310s1c1
Sequence:CCGGGCTGGGTCTTTAAGAAAGGTACTCGAGTACCTTTCTTAAAGACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012014.1-2673s1c1
Sequence:CCGGGCTTCTTTCAAGCCCTTCCTTCTCGAGAAGGAAGGGCTTGAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052899
GPRIN1 MISSION shRNA Bacterial Glycerol Stock
G protein regulated inducer of neurite outgrowth 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-658s1c1
Sequence:CCGGCGATTCCACTTCCATAGGAAACTCGAGTTTCCTATGGAAGTGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-2017s1c1
Sequence:CCGGGAGTCCTGTTACCACCACAAACTCGAGTTTGTGGTGGTAACAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-1238s1c1
Sequence:CCGGCCCGCATCTGTGGGAAATGTACTCGAGTACATTTCCCACAGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-1612s1c1
Sequence:CCGGGAATCCTGAGTCTTCAGGAAACTCGAGTTTCCTGAAGACTCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-782s1c1
Sequence:CCGGCCCATGACTGTAAGAAAGGAACTCGAGTTCCTTTCTTACAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052899.2-835s21c1
Sequence:CCGGGTGCTCCAGCAAGACGTATACCTCGAGGTATACGTCTTGCTGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052899.2-1153s21c1
Sequence:CCGGAGGCAAGAATGGGCCTGTATCCTCGAGGATACAGGCCCATTCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052899.2-1019s21c1
Sequence:CCGGGATCTTGTATTGTCGGGAAAGCTCGAGCTTTCCCGACAATACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052899
GPRIN1 MISSION shRNA shRNA Plasmid DNA
G protein regulated inducer of neurite outgrowth 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-658s1c1
Sequence:CCGGCGATTCCACTTCCATAGGAAACTCGAGTTTCCTATGGAAGTGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-2017s1c1
Sequence:CCGGGAGTCCTGTTACCACCACAAACTCGAGTTTGTGGTGGTAACAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-1238s1c1
Sequence:CCGGCCCGCATCTGTGGGAAATGTACTCGAGTACATTTCCCACAGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-1612s1c1
Sequence:CCGGGAATCCTGAGTCTTCAGGAAACTCGAGTTTCCTGAAGACTCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-782s1c1
Sequence:CCGGCCCATGACTGTAAGAAAGGAACTCGAGTTCCTTTCTTACAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052899.2-835s21c1
Sequence:CCGGGTGCTCCAGCAAGACGTATACCTCGAGGTATACGTCTTGCTGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052899.2-1153s21c1
Sequence:CCGGAGGCAAGAATGGGCCTGTATCCTCGAGGATACAGGCCCATTCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052899.2-1019s21c1
Sequence:CCGGGATCTTGTATTGTCGGGAAAGCTCGAGCTTTCCCGACAATACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052899
GPRIN1 MISSION shRNA Lentiviral Transduction Particles
G protein regulated inducer of neurite outgrowth 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-658s1c1
Sequence:CCGGCGATTCCACTTCCATAGGAAACTCGAGTTTCCTATGGAAGTGGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-2017s1c1
Sequence:CCGGGAGTCCTGTTACCACCACAAACTCGAGTTTGTGGTGGTAACAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-1238s1c1
Sequence:CCGGCCCGCATCTGTGGGAAATGTACTCGAGTACATTTCCCACAGATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-1612s1c1
Sequence:CCGGGAATCCTGAGTCTTCAGGAAACTCGAGTTTCCTGAAGACTCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052899.1-782s1c1
Sequence:CCGGCCCATGACTGTAAGAAAGGAACTCGAGTTCCTTTCTTACAGTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052899.2-835s21c1
Sequence:CCGGGTGCTCCAGCAAGACGTATACCTCGAGGTATACGTCTTGCTGGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052899.2-1153s21c1
Sequence:CCGGAGGCAAGAATGGGCCTGTATCCTCGAGGATACAGGCCCATTCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052899.2-1019s21c1
Sequence:CCGGGATCTTGTATTGTCGGGAAAGCTCGAGCTTTCCCGACAATACAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks