EMAIL THIS PAGE TO A FRIEND

GPS1

G protein pathway suppressor 1

64 Gene Product Result for
Synonyms: COPS1 CSN1
UniProtKB ID: Q13098, Q8NA10, Q9BWL1
Gene ID:
Human(2873) Summary: This gene is known to suppress G-protein and mitogen-activated signal transduction in mammalian cells. The encoded protein shares significant similarity with Arabidopsis FUS6, which is a regulator of light-mediated signal transduction in plant cells. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(209318) G protein pathway suppressor 1
Rat(117039) G protein pathway suppressor 1
Zebrafish(777711) G protein pathway suppressor 1
Thale Cress(818028) geranyl diphosphate synthase 1
cow(525572) G protein pathway suppressor 1
domestic cat(101081015) G protein pathway suppressor 1
dog(483377) G protein pathway suppressor 1
chicken(417382) G protein pathway suppressor 1
domestic guinea pig(100713341) G protein pathway suppressor 1
naked mole-rat(101726586) G protein pathway suppressor 1
sheep(101112147) G protein pathway suppressor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004127 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004127 Rosetta Predictions human pricing
NM_212492 Rosetta Predictions human pricing
NM_053969 Rosetta Predictions rat pricing
NM_145370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076079 predicted 1023
2 SASI_Hs01_00076080 predicted 1063
3 SASI_Hs01_00076081 predicted 680
4 SASI_Hs01_00076082 predicted 672
5 SASI_Hs01_00076083 predicted 1039
6 SASI_Hs02_00336978 predicted 1184
7 SASI_Hs01_00076084 predicted 1187
8 SASI_Hs01_00076085 predicted 645
9 SASI_Hs01_00076086 predicted 684
10 SASI_Hs01_00076087 predicted 1090
11 SASI_Hs01_00076088 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223933 predicted 1502
2 SASI_Hs01_00223934 predicted 1542
3 SASI_Hs01_00223935 predicted 1169
4 SASI_Hs01_00223936 predicted 1152
5 SASI_Hs01_00223937 predicted 1525
6 SASI_Hs02_00374211 predicted 1669
7 SASI_Hs01_00223938 predicted 1669
8 SASI_Hs01_00223939 predicted 1132
9 SASI_Hs01_00223940 predicted 1172
10 SASI_Hs01_00223941 predicted 1575
11 SASI_Hs01_00223942 predicted 1832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049254 predicted 742
2 SASI_Rn01_00049255 predicted 551
3 SASI_Rn01_00049256 predicted 1528
4 SASI_Rn01_00049257 predicted 312
5 SASI_Rn01_00049258 predicted 532
6 SASI_Rn01_00049259 predicted 711
7 SASI_Rn01_00049260 predicted 536
8 SASI_Rn01_00049261 predicted 1153
9 SASI_Rn01_00049262 predicted 768
10 SASI_Rn01_00049263 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114772 predicted 744
2 SASI_Mm01_00114773 predicted 349
3 SASI_Mm01_00114774 predicted 1554
4 SASI_Mm01_00114775 predicted 1163
5 SASI_Mm01_00114776 predicted 351
6 SASI_Mm02_00340649 predicted 1187
7 SASI_Mm01_00114778 predicted 705
8 SASI_Mm02_00340650 predicted 619
9 SASI_Mm01_00114779 predicted 809
10 SASI_Mm01_00114780 predicted 1383
11 SASI_Mm01_00114777 predicted 752
12 SASI_Mm01_00114781 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145370
VALIDATED
GPS1 MISSION shRNA Bacterial Glycerol Stock
G protein pathway suppressor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-604s21c1
Sequence:CCGGCACGGACTTGAAGAACTATAACTCGAGTTATAGTTCTTCAAGTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-1745s21c1
Sequence:CCGGCAGACTGTGTGTGGTTCATTACTCGAGTAATGAACCACACACAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145370.1-1387s21c1
Sequence:CCGGCATTCTGGAGGGCCTTATTAACTCGAGTTAATAAGGCCCTCCAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-264s21c1
Sequence:CCGGACGCACCTGATGTCAACTATGCTCGAGCATAGTTGACATCAGGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-1508s21c1
Sequence:CCGGCGACGTGCCAAAGCTATGATTCTCGAGAATCATAGCTTTGGCACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1508s1c1
Sequence:CCGGCGACGTGCCAAAGCTATGATTCTCGAGAATCATAGCTTTGGCACGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1618s1c1
Sequence:CCGGGTCACGCATGAGTACCAACATCTCGAGATGTTGGTACTCATGCGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1073s1c1
Sequence:CCGGCGGCAGGAGCTGCAACGAAATCTCGAGATTTCGTTGCAGCTCCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-604s1c1
Sequence:CCGGCACGGACTTGAAGAACTATAACTCGAGTTATAGTTCTTCAAGTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1337s1c1
Sequence:CCGGGCAGCCTTCAACACAACAGTTCTCGAGAACTGTTGTGTTGAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145370
VALIDATED
GPS1 MISSION shRNA shRNA Plasmid DNA
G protein pathway suppressor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-604s21c1
Sequence:CCGGCACGGACTTGAAGAACTATAACTCGAGTTATAGTTCTTCAAGTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-1745s21c1
Sequence:CCGGCAGACTGTGTGTGGTTCATTACTCGAGTAATGAACCACACACAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145370.1-1387s21c1
Sequence:CCGGCATTCTGGAGGGCCTTATTAACTCGAGTTAATAAGGCCCTCCAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-264s21c1
Sequence:CCGGACGCACCTGATGTCAACTATGCTCGAGCATAGTTGACATCAGGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-1508s21c1
Sequence:CCGGCGACGTGCCAAAGCTATGATTCTCGAGAATCATAGCTTTGGCACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1508s1c1
Sequence:CCGGCGACGTGCCAAAGCTATGATTCTCGAGAATCATAGCTTTGGCACGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1618s1c1
Sequence:CCGGGTCACGCATGAGTACCAACATCTCGAGATGTTGGTACTCATGCGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1073s1c1
Sequence:CCGGCGGCAGGAGCTGCAACGAAATCTCGAGATTTCGTTGCAGCTCCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-604s1c1
Sequence:CCGGCACGGACTTGAAGAACTATAACTCGAGTTATAGTTCTTCAAGTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1337s1c1
Sequence:CCGGGCAGCCTTCAACACAACAGTTCTCGAGAACTGTTGTGTTGAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145370
VALIDATED
GPS1 MISSION shRNA Lentiviral Transduction Particles
G protein pathway suppressor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-604s21c1
Sequence:CCGGCACGGACTTGAAGAACTATAACTCGAGTTATAGTTCTTCAAGTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-1745s21c1
Sequence:CCGGCAGACTGTGTGTGGTTCATTACTCGAGTAATGAACCACACACAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145370.1-1387s21c1
Sequence:CCGGCATTCTGGAGGGCCTTATTAACTCGAGTTAATAAGGCCCTCCAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-264s21c1
Sequence:CCGGACGCACCTGATGTCAACTATGCTCGAGCATAGTTGACATCAGGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145370.1-1508s21c1
Sequence:CCGGCGACGTGCCAAAGCTATGATTCTCGAGAATCATAGCTTTGGCACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1508s1c1
Sequence:CCGGCGACGTGCCAAAGCTATGATTCTCGAGAATCATAGCTTTGGCACGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1618s1c1
Sequence:CCGGGTCACGCATGAGTACCAACATCTCGAGATGTTGGTACTCATGCGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1073s1c1
Sequence:CCGGCGGCAGGAGCTGCAACGAAATCTCGAGATTTCGTTGCAGCTCCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-604s1c1
Sequence:CCGGCACGGACTTGAAGAACTATAACTCGAGTTATAGTTCTTCAAGTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145370.1-1337s1c1
Sequence:CCGGGCAGCCTTCAACACAACAGTTCTCGAGAACTGTTGTGTTGAAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004127
VALIDATED
GPS1 MISSION shRNA Bacterial Glycerol Stock
G protein pathway suppressor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-294s21c1
Sequence:CCGGGAGAACCTTTAACGTGGACATCTCGAGATGTCCACGTTAAAGGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-1425s21c1
Sequence:CCGGCCGCAACCAGATCCATGTCAACTCGAGTTGACATGGATCTGGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-1023s21c1
Sequence:CCGGCCGAGACATCATCTTCAAATTCTCGAGAATTTGAAGATGATGTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-1158s21c1
Sequence:CCGGCCGTGCCCTCATCCAGTATTTCTCGAGAAATACTGGATGAGGGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-50s21c1
Sequence:CCGGCGCTGCCGGTTCAGGTGTTTACTCGAGTAAACACCTGAACCGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004127.3-1160s1c1
Sequence:CCGGCCGTGCCCTCATCCAGTATTTCTCGAGAAATACTGGATGAGGGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004127.3-64s1c1
Sequence:CCGGCGCTGCCGGTTCAGGTGTTTACTCGAGTAAACACCTGAACCGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004127.3-1427s1c1
Sequence:CCGGCCGCAACCAGATCCATGTCAACTCGAGTTGACATGGATCTGGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004127.3-308s1c1
Sequence:CCGGGAGAACCTTTAACGTGGACATCTCGAGATGTCCACGTTAAAGGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004127.3-1025s1c1
Sequence:CCGGCCGAGACATCATCTTCAAATTCTCGAGAATTTGAAGATGATGTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004127
VALIDATED
GPS1 MISSION shRNA shRNA Plasmid DNA
G protein pathway suppressor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-294s21c1
Sequence:CCGGGAGAACCTTTAACGTGGACATCTCGAGATGTCCACGTTAAAGGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-1425s21c1
Sequence:CCGGCCGCAACCAGATCCATGTCAACTCGAGTTGACATGGATCTGGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-1023s21c1
Sequence:CCGGCCGAGACATCATCTTCAAATTCTCGAGAATTTGAAGATGATGTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-1158s21c1
Sequence:CCGGCCGTGCCCTCATCCAGTATTTCTCGAGAAATACTGGATGAGGGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-50s21c1
Sequence:CCGGCGCTGCCGGTTCAGGTGTTTACTCGAGTAAACACCTGAACCGGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004127.3-1160s1c1
Sequence:CCGGCCGTGCCCTCATCCAGTATTTCTCGAGAAATACTGGATGAGGGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004127.3-64s1c1
Sequence:CCGGCGCTGCCGGTTCAGGTGTTTACTCGAGTAAACACCTGAACCGGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004127.3-1427s1c1
Sequence:CCGGCCGCAACCAGATCCATGTCAACTCGAGTTGACATGGATCTGGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004127.3-308s1c1
Sequence:CCGGGAGAACCTTTAACGTGGACATCTCGAGATGTCCACGTTAAAGGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004127.3-1025s1c1
Sequence:CCGGCCGAGACATCATCTTCAAATTCTCGAGAATTTGAAGATGATGTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004127
VALIDATED
GPS1 MISSION shRNA Lentiviral Transduction Particles
G protein pathway suppressor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-294s21c1
Sequence:CCGGGAGAACCTTTAACGTGGACATCTCGAGATGTCCACGTTAAAGGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-1425s21c1
Sequence:CCGGCCGCAACCAGATCCATGTCAACTCGAGTTGACATGGATCTGGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-1023s21c1
Sequence:CCGGCCGAGACATCATCTTCAAATTCTCGAGAATTTGAAGATGATGTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-1158s21c1
Sequence:CCGGCCGTGCCCTCATCCAGTATTTCTCGAGAAATACTGGATGAGGGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004127.4-50s21c1
Sequence:CCGGCGCTGCCGGTTCAGGTGTTTACTCGAGTAAACACCTGAACCGGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004127.3-1160s1c1
Sequence:CCGGCCGTGCCCTCATCCAGTATTTCTCGAGAAATACTGGATGAGGGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004127.3-64s1c1
Sequence:CCGGCGCTGCCGGTTCAGGTGTTTACTCGAGTAAACACCTGAACCGGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004127.3-1427s1c1
Sequence:CCGGCCGCAACCAGATCCATGTCAACTCGAGTTGACATGGATCTGGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004127.3-308s1c1
Sequence:CCGGGAGAACCTTTAACGTGGACATCTCGAGATGTCCACGTTAAAGGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004127.3-1025s1c1
Sequence:CCGGCCGAGACATCATCTTCAAATTCTCGAGAATTTGAAGATGATGTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)