EMAIL THIS PAGE TO A FRIEND

GPS2

G protein pathway suppressor 2

Synonyms: AMF-1
UniProtKB ID: Q13227, Q6FHM8
Gene ID:
Human(2874) Summary: This gene encodes a protein involved in G protein-mitogen-activated protein kinase (MAPK) signaling cascades. When overexpressed in mammalian cells, this gene could potently suppress a RAS- and MAPK-mediated signal and interfere with JNK activity, suggesting that the function of this gene may be signal repression. The encoded protein is an integral subunit of the NCOR1-HDAC3 (nuclear receptor corepressor 1-histone deacetylase 3) complex, and it was shown that the complex inhibits JNK activation through this subunit and thus could potentially provide an alternative mechanism for hormone-mediated antagonism of AP1 (activator protein 1) function. [provided by RefSeq, Jul 2008]
Mouse(56310) G protein pathway suppressor 2
Rat(497941) G protein pathway suppressor 2
sheep(101119059) G protein pathway suppressor 2
domestic guinea pig(100716061) G protein pathway suppressor 2
naked mole-rat(101716315) G protein pathway suppressor 2
Zebrafish(393948) G protein pathway suppressor 2
dog(607730) G protein pathway suppressor 2
cow(518494) G protein pathway suppressor 2
domestic cat(101096521) G protein pathway suppressor 2
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004489 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073731 MISSION® esiRNA esiRNA targeting mouse Gps2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004489 Rosetta Predictions human pricing
NM_001017477 Rosetta Predictions rat pricing
NM_019726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092267 predicted 852
2 SASI_Hs02_00337728 predicted 678
3 SASI_Hs01_00092268 predicted 702
4 SASI_Hs01_00092269 predicted 590
5 SASI_Hs01_00092270 predicted 838
6 SASI_Hs02_00337729 predicted 695
7 SASI_Hs01_00092271 predicted 761
8 SASI_Hs01_00092272 predicted 675
9 SASI_Hs01_00092273 predicted 630
10 SASI_Hs01_00092274 predicted 714
11 SASI_Hs01_00092275 predicted 656
12 SASI_Hs01_00092276 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202286 predicted 861
2 SASI_Rn01_00102661 predicted 833
3 SASI_Rn01_00102662 predicted 915
4 SASI_Rn01_00102664 predicted 969
5 SASI_Rn02_00202287 predicted 906
6 SASI_Rn01_00102665 predicted 873
7 SASI_Rn01_00102666 predicted 1021
8 SASI_Rn01_00102667 predicted 968
9 SASI_Rn01_00102668 predicted 1067
10 SASI_Rn01_00102669 predicted 943
11 SASI_Rn01_00102663 predicted 984
12 SASI_Rn01_00102670 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054033 predicted 699
2 SASI_Mm01_00054034 predicted 931
3 SASI_Mm02_00324859 predicted 597
4 SASI_Mm02_00324860 predicted 844
5 SASI_Mm02_00324861 predicted 881
6 SASI_Mm02_00324862 predicted 733
7 SASI_Mm02_00324863 predicted 836
8 SASI_Mm02_00324864 predicted 749
9 SASI_Mm02_00324865 predicted 840
10 SASI_Mm02_00324866 predicted 739
11 SASI_Mm01_00054035 predicted 936
12 SASI_Mm01_00054036 predicted 196
13 SASI_Mm01_00054037 predicted 451
14 SASI_Mm01_00054038 predicted 464
15 SASI_Mm01_00054039 predicted 1102
16 SASI_Mm01_00054040 predicted 1098
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019726
VALIDATED
GPS2 MISSION shRNA Bacterial Glycerol Stock
G protein pathway suppressor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019726.2-671s1c1
Sequence:CCGGCCAGAACATGGACAATTCCAACTCGAGTTGGAATTGTCCATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019726.2-475s1c1
Sequence:CCGGCACTCTGACATCAGCTGCATACTCGAGTATGCAGCTGATGTCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019726.2-1027s1c1
Sequence:CCGGACAGATACAAGCAGCAGGGAACTCGAGTTCCCTGCTGCTTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019726.2-889s1c1
Sequence:CCGGCAGTACCCTCTCTTTGCAGAACTCGAGTTCTGCAAAGAGAGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-741s21c1
Sequence:CCGGGGCCAACACAACCAGCCTATACTCGAGTATAGGCTGGTTGTGTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-264s21c1
Sequence:CCGGTGATGGAACAGAAGATGAAAGCTCGAGCTTTCATCTTCTGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-837s21c1
Sequence:CCGGATGCAGTGCATGGCCACTTTCCTCGAGGAAAGTGGCCATGCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-596s21c1
Sequence:CCGGGCCAAGCAGATGTTTGGACCACTCGAGTGGTCCAAACATCTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-889s21c1
Sequence:CCGGCAGTACCCTCTCTTTGCAGAACTCGAGTTCTGCAAAGAGAGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019726
VALIDATED
GPS2 MISSION shRNA shRNA Plasmid DNA
G protein pathway suppressor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019726.2-671s1c1
Sequence:CCGGCCAGAACATGGACAATTCCAACTCGAGTTGGAATTGTCCATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019726.2-475s1c1
Sequence:CCGGCACTCTGACATCAGCTGCATACTCGAGTATGCAGCTGATGTCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019726.2-1027s1c1
Sequence:CCGGACAGATACAAGCAGCAGGGAACTCGAGTTCCCTGCTGCTTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019726.2-889s1c1
Sequence:CCGGCAGTACCCTCTCTTTGCAGAACTCGAGTTCTGCAAAGAGAGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-741s21c1
Sequence:CCGGGGCCAACACAACCAGCCTATACTCGAGTATAGGCTGGTTGTGTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-264s21c1
Sequence:CCGGTGATGGAACAGAAGATGAAAGCTCGAGCTTTCATCTTCTGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-837s21c1
Sequence:CCGGATGCAGTGCATGGCCACTTTCCTCGAGGAAAGTGGCCATGCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-596s21c1
Sequence:CCGGGCCAAGCAGATGTTTGGACCACTCGAGTGGTCCAAACATCTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-889s21c1
Sequence:CCGGCAGTACCCTCTCTTTGCAGAACTCGAGTTCTGCAAAGAGAGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019726
VALIDATED
GPS2 MISSION shRNA Lentiviral Transduction Particles
G protein pathway suppressor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019726.2-671s1c1
Sequence:CCGGCCAGAACATGGACAATTCCAACTCGAGTTGGAATTGTCCATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019726.2-475s1c1
Sequence:CCGGCACTCTGACATCAGCTGCATACTCGAGTATGCAGCTGATGTCAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019726.2-1027s1c1
Sequence:CCGGACAGATACAAGCAGCAGGGAACTCGAGTTCCCTGCTGCTTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019726.2-889s1c1
Sequence:CCGGCAGTACCCTCTCTTTGCAGAACTCGAGTTCTGCAAAGAGAGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-741s21c1
Sequence:CCGGGGCCAACACAACCAGCCTATACTCGAGTATAGGCTGGTTGTGTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-264s21c1
Sequence:CCGGTGATGGAACAGAAGATGAAAGCTCGAGCTTTCATCTTCTGTTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-837s21c1
Sequence:CCGGATGCAGTGCATGGCCACTTTCCTCGAGGAAAGTGGCCATGCACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-596s21c1
Sequence:CCGGGCCAAGCAGATGTTTGGACCACTCGAGTGGTCCAAACATCTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019726.3-889s21c1
Sequence:CCGGCAGTACCCTCTCTTTGCAGAACTCGAGTTCTGCAAAGAGAGGGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004489
VALIDATED
GPS2 MISSION shRNA Bacterial Glycerol Stock
G protein pathway suppressor 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004489.3-3078s1c1
Sequence:CCGGGACAGAGCCAAACAAATGTTTCTCGAGAAACATTTGTTTGGCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004489.3-3578s1c1
Sequence:CCGGCTTCATCCAACACAGCCAGAACTCGAGTTCTGGCTGTGTTGGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004489.3-3159s1c1
Sequence:CCGGCCAGAGCATGGACAATTCCAACTCGAGTTGGAATTGTCCATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004489.3-2823s1c1
Sequence:CCGGGAGGAGACCAAGGAACAAATTCTCGAGAATTTGTTCCTTGGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004489.3-3239s1c1
Sequence:CCGGGCCAGCTTATAGTCCTAGTCACTCGAGTGACTAGGACTATAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-429s21c1
Sequence:CCGGAGAGCCTGACTGTTCACACAGCTCGAGCTGTGTGAACAGTCAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-972s21c1
Sequence:CCGGGAAAGTCGGGCTTTGCAGCTACTCGAGTAGCTGCAAAGCCCGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-127s21c1
Sequence:CCGGGCTGCACCGGCACATTATGATCTCGAGATCATAATGTGCCGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-184s21c1
Sequence:CCGGGGATAAGATGATGGAACAGAACTCGAGTTCTGTTCCATCATCTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-452s21c1
Sequence:CCGGACTCATCTCCTCAGCATGCAGCTCGAGCTGCATGCTGAGGAGATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-1040s21c1
Sequence:CCGGCCGCGATTCTACCACAAGTGACTCGAGTCACTTGTGGTAGAATCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004489
VALIDATED
GPS2 MISSION shRNA shRNA Plasmid DNA
G protein pathway suppressor 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004489.3-3078s1c1
Sequence:CCGGGACAGAGCCAAACAAATGTTTCTCGAGAAACATTTGTTTGGCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004489.3-3578s1c1
Sequence:CCGGCTTCATCCAACACAGCCAGAACTCGAGTTCTGGCTGTGTTGGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004489.3-3159s1c1
Sequence:CCGGCCAGAGCATGGACAATTCCAACTCGAGTTGGAATTGTCCATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004489.3-2823s1c1
Sequence:CCGGGAGGAGACCAAGGAACAAATTCTCGAGAATTTGTTCCTTGGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004489.3-3239s1c1
Sequence:CCGGGCCAGCTTATAGTCCTAGTCACTCGAGTGACTAGGACTATAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-429s21c1
Sequence:CCGGAGAGCCTGACTGTTCACACAGCTCGAGCTGTGTGAACAGTCAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-972s21c1
Sequence:CCGGGAAAGTCGGGCTTTGCAGCTACTCGAGTAGCTGCAAAGCCCGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-127s21c1
Sequence:CCGGGCTGCACCGGCACATTATGATCTCGAGATCATAATGTGCCGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-184s21c1
Sequence:CCGGGGATAAGATGATGGAACAGAACTCGAGTTCTGTTCCATCATCTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-452s21c1
Sequence:CCGGACTCATCTCCTCAGCATGCAGCTCGAGCTGCATGCTGAGGAGATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-1040s21c1
Sequence:CCGGCCGCGATTCTACCACAAGTGACTCGAGTCACTTGTGGTAGAATCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004489
VALIDATED
GPS2 MISSION shRNA Lentiviral Transduction Particles
G protein pathway suppressor 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004489.3-3078s1c1
Sequence:CCGGGACAGAGCCAAACAAATGTTTCTCGAGAAACATTTGTTTGGCTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004489.3-3578s1c1
Sequence:CCGGCTTCATCCAACACAGCCAGAACTCGAGTTCTGGCTGTGTTGGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004489.3-3159s1c1
Sequence:CCGGCCAGAGCATGGACAATTCCAACTCGAGTTGGAATTGTCCATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004489.3-2823s1c1
Sequence:CCGGGAGGAGACCAAGGAACAAATTCTCGAGAATTTGTTCCTTGGTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004489.3-3239s1c1
Sequence:CCGGGCCAGCTTATAGTCCTAGTCACTCGAGTGACTAGGACTATAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-429s21c1
Sequence:CCGGAGAGCCTGACTGTTCACACAGCTCGAGCTGTGTGAACAGTCAGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-972s21c1
Sequence:CCGGGAAAGTCGGGCTTTGCAGCTACTCGAGTAGCTGCAAAGCCCGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-127s21c1
Sequence:CCGGGCTGCACCGGCACATTATGATCTCGAGATCATAATGTGCCGGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-184s21c1
Sequence:CCGGGGATAAGATGATGGAACAGAACTCGAGTTCTGTTCCATCATCTTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-452s21c1
Sequence:CCGGACTCATCTCCTCAGCATGCAGCTCGAGCTGCATGCTGAGGAGATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004489.4-1040s21c1
Sequence:CCGGCCGCGATTCTACCACAAGTGACTCGAGTCACTTGTGGTAGAATCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks