EMAIL THIS PAGE TO A FRIEND

GPSM1

G-protein signaling modulator 1

49 Gene Product Result for
Synonyms: AGS3
UniProtKB ID: Q86YR5, A9Z1X4, B1B0W3, Q86SR5, Q969T1, Q9UFS8
Gene ID:
Human(26086) Summary: G-protein signaling modulators (GPSMs) play diverse functional roles through their interaction with G-protein subunits. This gene encodes a receptor-independent activator of G protein signaling, which is one of several factors that influence the basal activity of G-protein signaling systems. The protein contains seven tetratricopeptide repeats in its N-terminal half and four G-protein regulatory (GPR) motifs in its C-terminal half. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(67839) G-protein signalling modulator 1 (AGS3-like, C. elegans)
Rat(246254) G-protein signaling modulator 1
chicken(417132) G-protein signaling modulator 1
cow(100139799) G-protein signaling modulator 1
domestic cat(101088790) G-protein signaling modulator 1
dog(491252) G-protein signaling modulator 1
domestic guinea pig(100712752) G-protein signaling modulator 1
naked mole-rat(101724892) G-protein signaling modulator 1
sheep(101116818) G-protein signaling modulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015597 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015597 Rosetta Predictions human pricing
NM_144745 Rosetta Predictions rat pricing
NM_153410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083170 predicted 719
2 SASI_Hs01_00083171 predicted 367
3 SASI_Hs01_00083172 predicted 925
4 SASI_Hs01_00083173 predicted 382
5 SASI_Hs01_00083174 predicted 483
6 SASI_Hs01_00083175 predicted 1652
7 SASI_Hs01_00083176 predicted 672
8 SASI_Hs01_00083177 predicted 852
9 SASI_Hs01_00083178 predicted 320
10 SASI_Hs02_00348178 predicted 632
11 SASI_Hs01_00083179 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062966 predicted 908
2 SASI_Rn01_00062967 predicted 988
3 SASI_Rn01_00062968 predicted 1854
4 SASI_Rn02_00268626 predicted 925
5 SASI_Rn01_00062969 predicted 2124
6 SASI_Rn01_00062970 predicted 1583
7 SASI_Rn01_00062971 predicted 1846
8 SASI_Rn01_00062972 predicted 681
9 SASI_Rn01_00062973 predicted 1306
10 SASI_Rn01_00062974 predicted 599
11 SASI_Rn01_00062975 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047774 predicted 546
2 SASI_Mm01_00047776 predicted 1994
3 SASI_Mm01_00047777 predicted 1455
4 SASI_Mm01_00047778 predicted 973
5 SASI_Mm01_00047779 predicted 2213
6 SASI_Mm01_00047780 predicted 1197
7 SASI_Mm01_00047781 predicted 1983
8 SASI_Mm02_00343196 predicted 331
9 SASI_Mm01_00047782 predicted 500
10 SASI_Mm01_00047783 predicted 1209
11 SASI_Mm01_00047775 predicted 2224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015597
GPSM1 MISSION shRNA Bacterial Glycerol Stock
G-protein signaling modulator 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015597.4-690s21c1
Sequence:CCGGACGCCAAAGGCAAGCAACTGTCTCGAGACAGTTGCTTGCCTTTGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015597.4-667s21c1
Sequence:CCGGCTACAACATCGGGAACGTGTACTCGAGTACACGTTCCCGATGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-573s1c1
Sequence:CCGGCCTGGGCAACACCCACTATTTCTCGAGAAATAGTGGGTGTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-150s1c1
Sequence:CCGGCAACGCCTACTTCTACCTGAACTCGAGTTCAGGTAGAAGTAGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-1418s1c1
Sequence:CCGGAGTGCTTCTTTGACCTGTTGACTCGAGTCAACAGGTCAAAGAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-645s1c1
Sequence:CCGGTGCTAAGGAGTTTGGAGACAACTCGAGTTGTCTCCAAACTCCTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-1656s1c1
Sequence:CCGGGCTGCGAATCACCCACAGCAACTCGAGTTGCTGTGGGTGATTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015597
GPSM1 MISSION shRNA shRNA Plasmid DNA
G-protein signaling modulator 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015597.4-690s21c1
Sequence:CCGGACGCCAAAGGCAAGCAACTGTCTCGAGACAGTTGCTTGCCTTTGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015597.4-667s21c1
Sequence:CCGGCTACAACATCGGGAACGTGTACTCGAGTACACGTTCCCGATGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-573s1c1
Sequence:CCGGCCTGGGCAACACCCACTATTTCTCGAGAAATAGTGGGTGTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-150s1c1
Sequence:CCGGCAACGCCTACTTCTACCTGAACTCGAGTTCAGGTAGAAGTAGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-1418s1c1
Sequence:CCGGAGTGCTTCTTTGACCTGTTGACTCGAGTCAACAGGTCAAAGAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-645s1c1
Sequence:CCGGTGCTAAGGAGTTTGGAGACAACTCGAGTTGTCTCCAAACTCCTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-1656s1c1
Sequence:CCGGGCTGCGAATCACCCACAGCAACTCGAGTTGCTGTGGGTGATTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015597
GPSM1 MISSION shRNA Lentiviral Transduction Particles
G-protein signaling modulator 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015597.4-690s21c1
Sequence:CCGGACGCCAAAGGCAAGCAACTGTCTCGAGACAGTTGCTTGCCTTTGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015597.4-667s21c1
Sequence:CCGGCTACAACATCGGGAACGTGTACTCGAGTACACGTTCCCGATGTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-573s1c1
Sequence:CCGGCCTGGGCAACACCCACTATTTCTCGAGAAATAGTGGGTGTTGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-150s1c1
Sequence:CCGGCAACGCCTACTTCTACCTGAACTCGAGTTCAGGTAGAAGTAGGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-1418s1c1
Sequence:CCGGAGTGCTTCTTTGACCTGTTGACTCGAGTCAACAGGTCAAAGAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-645s1c1
Sequence:CCGGTGCTAAGGAGTTTGGAGACAACTCGAGTTGTCTCCAAACTCCTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015597.2-1656s1c1
Sequence:CCGGGCTGCGAATCACCCACAGCAACTCGAGTTGCTGTGGGTGATTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153410
VALIDATED
GPSM1 MISSION shRNA Bacterial Glycerol Stock
G-protein signaling modulator 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-555s21c1
Sequence:CCGGGCACTCTACAACATTGGAAATCTCGAGATTTCCAATGTTGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-1146s21c1
Sequence:CCGGGCCTTGACCTTTGCCAAGAAACTCGAGTTTCTTGGCAAAGGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-1743s21c1
Sequence:CCGGCCACAGACAGAGGAGTTCTTTCTCGAGAAAGAACTCCTCTGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-758s21c1
Sequence:CCGGCCACTACCTACTGGGAAACTTCTCGAGAAGTTTCCCAGTAGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-556s1c1
Sequence:CCGGGCACTCTACAACATTGGAAATCTCGAGATTTCCAATGTTGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-1147s1c1
Sequence:CCGGGCCTTGACCTTTGCCAAGAAACTCGAGTTTCTTGGCAAAGGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-759s1c1
Sequence:CCGGCCACTACCTACTGGGAAACTTCTCGAGAAGTTTCCCAGTAGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-1523s1c1
Sequence:CCGGCACTGGACAGTGCTGATGTAACTCGAGTTACATCAGCACTGTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-1744s1c1
Sequence:CCGGCCACAGACAGAGGAGTTCTTTCTCGAGAAAGAACTCCTCTGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153410
VALIDATED
GPSM1 MISSION shRNA shRNA Plasmid DNA
G-protein signaling modulator 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-555s21c1
Sequence:CCGGGCACTCTACAACATTGGAAATCTCGAGATTTCCAATGTTGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-1146s21c1
Sequence:CCGGGCCTTGACCTTTGCCAAGAAACTCGAGTTTCTTGGCAAAGGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-1743s21c1
Sequence:CCGGCCACAGACAGAGGAGTTCTTTCTCGAGAAAGAACTCCTCTGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-758s21c1
Sequence:CCGGCCACTACCTACTGGGAAACTTCTCGAGAAGTTTCCCAGTAGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-556s1c1
Sequence:CCGGGCACTCTACAACATTGGAAATCTCGAGATTTCCAATGTTGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-1147s1c1
Sequence:CCGGGCCTTGACCTTTGCCAAGAAACTCGAGTTTCTTGGCAAAGGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-759s1c1
Sequence:CCGGCCACTACCTACTGGGAAACTTCTCGAGAAGTTTCCCAGTAGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-1523s1c1
Sequence:CCGGCACTGGACAGTGCTGATGTAACTCGAGTTACATCAGCACTGTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-1744s1c1
Sequence:CCGGCCACAGACAGAGGAGTTCTTTCTCGAGAAAGAACTCCTCTGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153410
VALIDATED
GPSM1 MISSION shRNA Lentiviral Transduction Particles
G-protein signaling modulator 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-555s21c1
Sequence:CCGGGCACTCTACAACATTGGAAATCTCGAGATTTCCAATGTTGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-1146s21c1
Sequence:CCGGGCCTTGACCTTTGCCAAGAAACTCGAGTTTCTTGGCAAAGGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-1743s21c1
Sequence:CCGGCCACAGACAGAGGAGTTCTTTCTCGAGAAAGAACTCCTCTGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153410.4-758s21c1
Sequence:CCGGCCACTACCTACTGGGAAACTTCTCGAGAAGTTTCCCAGTAGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-556s1c1
Sequence:CCGGGCACTCTACAACATTGGAAATCTCGAGATTTCCAATGTTGTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-1147s1c1
Sequence:CCGGGCCTTGACCTTTGCCAAGAAACTCGAGTTTCTTGGCAAAGGTCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-759s1c1
Sequence:CCGGCCACTACCTACTGGGAAACTTCTCGAGAAGTTTCCCAGTAGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-1523s1c1
Sequence:CCGGCACTGGACAGTGCTGATGTAACTCGAGTTACATCAGCACTGTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153410.2-1744s1c1
Sequence:CCGGCCACAGACAGAGGAGTTCTTTCTCGAGAAAGAACTCCTCTGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks