EMAIL THIS PAGE TO A FRIEND

GPSM2

G-protein signaling modulator 2

52 Gene Product Result for
Synonyms: CMCS DFNB82 LGN PINS
UniProtKB ID: P81274, Q5T1N8, Q6IBL7, Q8N0Z5
Gene ID:
Human(29899) Summary: The protein encoded by this gene belongs to a family of proteins that modulate activation of G proteins, which transduce extracellular signals received by cell surface receptors into integrated cellular responses. The N-terminal half of this protein contains 10 copies of leu-gly-asn (LGN) repeat, and the C-terminal half contains 4 GoLoco motifs, which are involved in guanine nucleotide exchange. This protein may play a role in neuroblast division and in the development of normal hearing. Mutations in this gene are associated with autosomal recessive nonsyndromic deafness (DFNB82).[provided by RefSeq, Jan 2011]
Mouse(76123) G-protein signalling modulator 2 (AGS3-like, C. elegans)
Rat(362021) G-protein signaling modulator 2
Zebrafish(393410) G-protein signalling modulator 2 (AGS3-like, C. elegans)
dog(490127) G-protein signaling modulator 2
domestic cat(101088422) G-protein signaling modulator 2
cow(513654) G-protein signaling modulator 2
Horse(100057975) G-protein signaling modulator 2
chicken(424342) G-protein signaling modulator 2
sheep(101122644) G-protein signaling modulator 2
Domestic Rabbit(100302676) G-protein signaling modulator 2
domestic guinea pig(100727455) G-protein signaling modulator 2
naked mole-rat(101721622) G-protein signaling modulator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013296 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013296 Rosetta Predictions human pricing
XM_575015 Rosetta Predictions rat pricing
NM_029522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121831 predicted 809
2 SASI_Hs01_00121832 predicted 1883
3 SASI_Hs01_00121834 predicted 1867
4 SASI_Hs01_00121835 predicted 1775
5 SASI_Hs01_00121836 predicted 1858
6 SASI_Hs01_00121837 predicted 907
7 SASI_Hs01_00121838 predicted 1418
8 SASI_Hs01_00121839 predicted 1056
9 SASI_Hs02_00344572 predicted 1955
10 SASI_Hs02_00344573 predicted 1407
11 SASI_Hs01_00121833 predicted 1416
12 SASI_Hs01_00121840 predicted 2040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402910 predicted 813
2 SASI_Rn02_00402911 predicted 1069
3 SASI_Rn02_00402912 predicted 2732
4 SASI_Rn02_00402913 predicted 2780
5 SASI_Rn02_00402914 predicted 2613
6 SASI_Rn02_00402915 predicted 2753
7 SASI_Rn02_00402916 predicted 764
8 SASI_Rn02_00402917 predicted 2654
9 SASI_Rn02_00402918 predicted 950
10 SASI_Rn02_00402919 predicted 2761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335468 predicted 2043
2 SASI_Mm01_00072345 predicted 1076
3 SASI_Mm01_00072347 predicted 1727
4 SASI_Mm01_00072348 predicted 2516
5 SASI_Mm01_00072350 predicted 764
6 SASI_Mm02_00335469 predicted 919
7 SASI_Mm01_00072351 predicted 2283
8 SASI_Mm01_00072352 predicted 586
9 SASI_Mm01_00072353 predicted 2137
10 SASI_Mm02_00335470 predicted 1190
11 SASI_Mm01_00072344 predicted 1618
12 SASI_Mm01_00072346 predicted 1268
13 SASI_Mm01_00072349 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013296
VALIDATED
GPSM2 MISSION shRNA Bacterial Glycerol Stock
G-protein signaling modulator 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-702s1c1
Sequence:CCGGGCACTTTACAATCTTGGGAATCTCGAGATTCCCAAGATTGTAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-1722s1c1
Sequence:CCGGGCAGATACTATTGGAGATGAACTCGAGTTCATCTCCAATAGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-2361s1c1
Sequence:CCGGCGGTAAGGAAACAATCTATTACTCGAGTAATAGATTGTTTCCTTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-2024s1c1
Sequence:CCGGCCTGATGACTAATGACAACAACTCGAGTTGTTGTCATTAGTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-497s1c1
Sequence:CCGGGCATGATTATGCCAAAGCATTCTCGAGAATGCTTTGGCATAATCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013296.4-868s21c1
Sequence:CCGGTTGTCAGCGACACCTAGATATCTCGAGATATCTAGGTGTCGCTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013296.4-761s21c1
Sequence:CCGGTTAACCCTTGCAAGGACTATTCTCGAGAATAGTCCTTGCAAGGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013296.4-2314s21c1
Sequence:CCGGATCCAGATTAGATGATCAAAGCTCGAGCTTTGATCATCTAATCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013296.4-2676s21c1
Sequence:CCGGGTTAACCTTCAGTAGTCTATTCTCGAGAATAGACTACTGAAGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013296
VALIDATED
GPSM2 MISSION shRNA shRNA Plasmid DNA
G-protein signaling modulator 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-702s1c1
Sequence:CCGGGCACTTTACAATCTTGGGAATCTCGAGATTCCCAAGATTGTAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-1722s1c1
Sequence:CCGGGCAGATACTATTGGAGATGAACTCGAGTTCATCTCCAATAGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-2361s1c1
Sequence:CCGGCGGTAAGGAAACAATCTATTACTCGAGTAATAGATTGTTTCCTTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-2024s1c1
Sequence:CCGGCCTGATGACTAATGACAACAACTCGAGTTGTTGTCATTAGTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-497s1c1
Sequence:CCGGGCATGATTATGCCAAAGCATTCTCGAGAATGCTTTGGCATAATCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013296.4-868s21c1
Sequence:CCGGTTGTCAGCGACACCTAGATATCTCGAGATATCTAGGTGTCGCTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013296.4-761s21c1
Sequence:CCGGTTAACCCTTGCAAGGACTATTCTCGAGAATAGTCCTTGCAAGGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013296.4-2314s21c1
Sequence:CCGGATCCAGATTAGATGATCAAAGCTCGAGCTTTGATCATCTAATCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013296.4-2676s21c1
Sequence:CCGGGTTAACCTTCAGTAGTCTATTCTCGAGAATAGACTACTGAAGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013296
VALIDATED
GPSM2 MISSION shRNA Lentiviral Transduction Particles
G-protein signaling modulator 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-702s1c1
Sequence:CCGGGCACTTTACAATCTTGGGAATCTCGAGATTCCCAAGATTGTAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-1722s1c1
Sequence:CCGGGCAGATACTATTGGAGATGAACTCGAGTTCATCTCCAATAGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006467    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-2361s1c1
Sequence:CCGGCGGTAAGGAAACAATCTATTACTCGAGTAATAGATTGTTTCCTTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-2024s1c1
Sequence:CCGGCCTGATGACTAATGACAACAACTCGAGTTGTTGTCATTAGTCATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_013296.3-497s1c1
Sequence:CCGGGCATGATTATGCCAAAGCATTCTCGAGAATGCTTTGGCATAATCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013296.4-868s21c1
Sequence:CCGGTTGTCAGCGACACCTAGATATCTCGAGATATCTAGGTGTCGCTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013296.4-761s21c1
Sequence:CCGGTTAACCCTTGCAAGGACTATTCTCGAGAATAGTCCTTGCAAGGGTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013296.4-2314s21c1
Sequence:CCGGATCCAGATTAGATGATCAAAGCTCGAGCTTTGATCATCTAATCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013296.4-2676s21c1
Sequence:CCGGGTTAACCTTCAGTAGTCTATTCTCGAGAATAGACTACTGAAGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029522
VALIDATED
GPSM2 MISSION shRNA Bacterial Glycerol Stock
G-protein signaling modulator 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029522.1-592s1c1
Sequence:CCGGGCGTTAGAATACCACCACCATCTCGAGATGGTGGTGGTATTCTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029522.1-2104s1c1
Sequence:CCGGCTGATGACAAATGACAAGAAACTCGAGTTTCTTGTCATTTGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029522.1-1102s1c1
Sequence:CCGGGCATACATATTCCTGGGTGAACTCGAGTTCACCCAGGAATATGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029522.1-1617s1c1
Sequence:CCGGGCCGAATTGGAACAGTGAAATCTCGAGATTTCACTGTTCCAATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029522.1-781s1c1
Sequence:CCGGGCGCTCTACAATCTTGGAAATCTCGAGATTTCCAAGATTGTAGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029522
VALIDATED
GPSM2 MISSION shRNA shRNA Plasmid DNA
G-protein signaling modulator 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029522.1-592s1c1
Sequence:CCGGGCGTTAGAATACCACCACCATCTCGAGATGGTGGTGGTATTCTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029522.1-2104s1c1
Sequence:CCGGCTGATGACAAATGACAAGAAACTCGAGTTTCTTGTCATTTGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029522.1-1102s1c1
Sequence:CCGGGCATACATATTCCTGGGTGAACTCGAGTTCACCCAGGAATATGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029522.1-1617s1c1
Sequence:CCGGGCCGAATTGGAACAGTGAAATCTCGAGATTTCACTGTTCCAATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029522.1-781s1c1
Sequence:CCGGGCGCTCTACAATCTTGGAAATCTCGAGATTTCCAAGATTGTAGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029522
VALIDATED
GPSM2 MISSION shRNA Lentiviral Transduction Particles
G-protein signaling modulator 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029522.1-592s1c1
Sequence:CCGGGCGTTAGAATACCACCACCATCTCGAGATGGTGGTGGTATTCTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029522.1-2104s1c1
Sequence:CCGGCTGATGACAAATGACAAGAAACTCGAGTTTCTTGTCATTTGTCATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029522.1-1102s1c1
Sequence:CCGGGCATACATATTCCTGGGTGAACTCGAGTTCACCCAGGAATATGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029522.1-1617s1c1
Sequence:CCGGGCCGAATTGGAACAGTGAAATCTCGAGATTTCACTGTTCCAATTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029522.1-781s1c1
Sequence:CCGGGCGCTCTACAATCTTGGAAATCTCGAGATTTCCAAGATTGTAGAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks