EMAIL THIS PAGE TO A FRIEND

GPSM3

G-protein signaling modulator 3

57 Gene Product Result for
Synonyms: AGS4 C6orf9 G18 G18.1a G18.1b G18.2 NG1
UniProtKB ID: Q9Y4H4, A2BFJ3
Gene ID:
Mouse(106512) G-protein signalling modulator 3 (AGS3-like, C. elegans)
Rat(406163) G-protein signaling modulator 3
domestic cat(101097560) G-protein signaling modulator 3
cow(516239) G-protein signaling modulator 3
dog(607687) G-protein signaling modulator 3
naked mole-rat(101707809) G-protein signaling modulator 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022107 Rosetta Predictions human pricing
NM_001003974 Rosetta Predictions rat pricing
NM_134116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131087 predicted 950
2 SASI_Hs01_00131088 predicted 689
3 SASI_Hs01_00131089 predicted 1220
4 SASI_Hs01_00131090 predicted 1040
5 SASI_Hs01_00131091 predicted 978
6 SASI_Hs01_00131093 predicted 840
7 SASI_Hs01_00131094 predicted 1160
8 SASI_Hs01_00131095 predicted 970
9 SASI_Hs01_00131096 predicted 901
10 SASI_Hs02_00355499 predicted 1007
11 SASI_Hs01_00131092 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048822 predicted 929
2 SASI_Rn02_00198077 predicted 840
3 SASI_Rn01_00048823 predicted 872
4 SASI_Rn01_00048824 predicted 916
5 SASI_Rn01_00048825 predicted 620
6 SASI_Rn01_00048826 predicted 622
7 SASI_Rn01_00048827 predicted 770
8 SASI_Rn01_00048828 predicted 735
9 SASI_Rn02_00198078 predicted 869
10 SASI_Rn01_00048830 predicted 996
11 SASI_Rn01_00048829 predicted 800
12 SASI_Rn01_00048831 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339361 predicted 653
2 SASI_Mm01_00131949 predicted 566
3 SASI_Mm01_00131950 predicted 461
4 SASI_Mm01_00131953 predicted 581
5 SASI_Mm01_00131954 predicted 600
6 SASI_Mm01_00131955 predicted 468
7 SASI_Mm01_00131956 predicted 463
8 SASI_Mm01_00131957 predicted 592
9 SASI_Mm01_00131958 predicted 624
10 SASI_Mm02_00339362 predicted 520
11 SASI_Mm01_00131951 predicted 521
12 SASI_Mm01_00131952 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022107
GPSM3 MISSION shRNA Bacterial Glycerol Stock
G-protein signaling modulator 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022107.1-1211s21c1
Sequence:CCGGGCCTCCACCTGAGAGGTTATACTCGAGTATAACCTCTCAGGTGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022107.1-879s21c1
Sequence:CCGGTCCTTGCCACTGGTCTCAAAGCTCGAGCTTTGAGACCAGTGGCAAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022107.1-782s21c1
Sequence:CCGGGAGTTGCTGCTGAGAGTTCAGCTCGAGCTGAACTCTCAGCAGCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-725s1c1
Sequence:CCGGCGGATGGAAGCCCAGCGGTCACTCGAGTGACCGCTGGGCTTCCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-456s1c1
Sequence:CCGGCCACCACTCGGCCTTGGCGATCTCGAGATCGCCAAGGCCGAGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-668s1c1
Sequence:CCGGCGTCCTCTCGAGGACAGAGAACTCGAGTTCTCTGTCCTCGAGAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-685s1c1
Sequence:CCGGAGAACAGCTTTACAGCACTATCTCGAGATAGTGCTGTAAAGCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022107.1-1044s1c1
Sequence:CCGGGCGAGATGGAACAGGGATTTACTCGAGTAAATCCCTGTTCCATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022107
GPSM3 MISSION shRNA shRNA Plasmid DNA
G-protein signaling modulator 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022107.1-1211s21c1
Sequence:CCGGGCCTCCACCTGAGAGGTTATACTCGAGTATAACCTCTCAGGTGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022107.1-879s21c1
Sequence:CCGGTCCTTGCCACTGGTCTCAAAGCTCGAGCTTTGAGACCAGTGGCAAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022107.1-782s21c1
Sequence:CCGGGAGTTGCTGCTGAGAGTTCAGCTCGAGCTGAACTCTCAGCAGCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-725s1c1
Sequence:CCGGCGGATGGAAGCCCAGCGGTCACTCGAGTGACCGCTGGGCTTCCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-456s1c1
Sequence:CCGGCCACCACTCGGCCTTGGCGATCTCGAGATCGCCAAGGCCGAGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-668s1c1
Sequence:CCGGCGTCCTCTCGAGGACAGAGAACTCGAGTTCTCTGTCCTCGAGAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-685s1c1
Sequence:CCGGAGAACAGCTTTACAGCACTATCTCGAGATAGTGCTGTAAAGCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022107.1-1044s1c1
Sequence:CCGGGCGAGATGGAACAGGGATTTACTCGAGTAAATCCCTGTTCCATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022107
GPSM3 MISSION shRNA Lentiviral Transduction Particles
G-protein signaling modulator 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022107.1-1211s21c1
Sequence:CCGGGCCTCCACCTGAGAGGTTATACTCGAGTATAACCTCTCAGGTGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022107.1-879s21c1
Sequence:CCGGTCCTTGCCACTGGTCTCAAAGCTCGAGCTTTGAGACCAGTGGCAAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022107.1-782s21c1
Sequence:CCGGGAGTTGCTGCTGAGAGTTCAGCTCGAGCTGAACTCTCAGCAGCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-725s1c1
Sequence:CCGGCGGATGGAAGCCCAGCGGTCACTCGAGTGACCGCTGGGCTTCCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-456s1c1
Sequence:CCGGCCACCACTCGGCCTTGGCGATCTCGAGATCGCCAAGGCCGAGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-668s1c1
Sequence:CCGGCGTCCTCTCGAGGACAGAGAACTCGAGTTCTCTGTCCTCGAGAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022107.1-685s1c1
Sequence:CCGGAGAACAGCTTTACAGCACTATCTCGAGATAGTGCTGTAAAGCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036819    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022107.1-1044s1c1
Sequence:CCGGGCGAGATGGAACAGGGATTTACTCGAGTAAATCCCTGTTCCATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134116
VALIDATED
GPSM3 MISSION shRNA Bacterial Glycerol Stock
G-protein signaling modulator 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-524s21c1
Sequence:CCGGGGAGTTGCTGCTGAGAGTTCACTCGAGTGAACTCTCAGCAGCAACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-442s21c1
Sequence:CCGGGCACCATCCTTAGTCACCAGTCTCGAGACTGGTGACTAAGGATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-411s21c1
Sequence:CCGGCGGCTTCTTGAAGACAAAGAACTCGAGTTCTTTGTCTTCAAGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-714s21c1
Sequence:CCGGGCTGTATTTACCACCCACTTTCTCGAGAAAGTGGGTGGTAAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134116.1-601s1c1
Sequence:CCGGGCTGTATTTACCACCCACTTTCTCGAGAAAGTGGGTGGTAAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134116.1-306s1c1
Sequence:CCGGTGAAGACAAAGAACAGCTCTACTCGAGTAGAGCTGTTCTTTGTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134116.1-40s1c1
Sequence:CCGGGAACAGAGTCTCCCGCAGGATCTCGAGATCCTGCGGGAGACTCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134116.1-298s1c1
Sequence:CCGGCGGCTTCTTGAAGACAAAGAACTCGAGTTCTTTGTCTTCAAGAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134116.1-196s1c1
Sequence:CCGGCTTCTGGACCTAGTGGCCGAACTCGAGTTCGGCCACTAGGTCCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134116
VALIDATED
GPSM3 MISSION shRNA shRNA Plasmid DNA
G-protein signaling modulator 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-524s21c1
Sequence:CCGGGGAGTTGCTGCTGAGAGTTCACTCGAGTGAACTCTCAGCAGCAACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-442s21c1
Sequence:CCGGGCACCATCCTTAGTCACCAGTCTCGAGACTGGTGACTAAGGATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-411s21c1
Sequence:CCGGCGGCTTCTTGAAGACAAAGAACTCGAGTTCTTTGTCTTCAAGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-714s21c1
Sequence:CCGGGCTGTATTTACCACCCACTTTCTCGAGAAAGTGGGTGGTAAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134116.1-601s1c1
Sequence:CCGGGCTGTATTTACCACCCACTTTCTCGAGAAAGTGGGTGGTAAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134116.1-306s1c1
Sequence:CCGGTGAAGACAAAGAACAGCTCTACTCGAGTAGAGCTGTTCTTTGTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134116.1-40s1c1
Sequence:CCGGGAACAGAGTCTCCCGCAGGATCTCGAGATCCTGCGGGAGACTCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134116.1-298s1c1
Sequence:CCGGCGGCTTCTTGAAGACAAAGAACTCGAGTTCTTTGTCTTCAAGAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134116.1-196s1c1
Sequence:CCGGCTTCTGGACCTAGTGGCCGAACTCGAGTTCGGCCACTAGGTCCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134116
VALIDATED
GPSM3 MISSION shRNA Lentiviral Transduction Particles
G-protein signaling modulator 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-524s21c1
Sequence:CCGGGGAGTTGCTGCTGAGAGTTCACTCGAGTGAACTCTCAGCAGCAACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-442s21c1
Sequence:CCGGGCACCATCCTTAGTCACCAGTCTCGAGACTGGTGACTAAGGATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-411s21c1
Sequence:CCGGCGGCTTCTTGAAGACAAAGAACTCGAGTTCTTTGTCTTCAAGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309021    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134116.4-714s21c1
Sequence:CCGGGCTGTATTTACCACCCACTTTCTCGAGAAAGTGGGTGGTAAATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134116.1-601s1c1
Sequence:CCGGGCTGTATTTACCACCCACTTTCTCGAGAAAGTGGGTGGTAAATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134116.1-306s1c1
Sequence:CCGGTGAAGACAAAGAACAGCTCTACTCGAGTAGAGCTGTTCTTTGTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134116.1-40s1c1
Sequence:CCGGGAACAGAGTCTCCCGCAGGATCTCGAGATCCTGCGGGAGACTCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134116.1-298s1c1
Sequence:CCGGCGGCTTCTTGAAGACAAAGAACTCGAGTTCTTTGTCTTCAAGAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134116.1-196s1c1
Sequence:CCGGCTTCTGGACCTAGTGGCCGAACTCGAGTTCGGCCACTAGGTCCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)