EMAIL THIS PAGE TO A FRIEND

GPT2

glutamic pyruvate transaminase (alanine aminotransferase) 2

99 Gene Product Result for
Synonyms: ALT2
UniProtKB ID: Q8TD30, Q8N9E2
Gene ID:
Human(84706) Summary: This gene encodes one of the two pyridoxal enzymes which catalyze a reversible transamination reaction to yield glutamate and pyruvate so these enzymes participate in amino acid metabolism and gluconeogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(108682) glutamic pyruvate transaminase (alanine aminotransferase) 2
Rat(307759) glutamic pyruvate transaminase (alanine aminotransferase) 2
Zebrafish(799963) glutamic pyruvate transaminase (alanine aminotransferase) 2
cow(618400) glutamic pyruvate transaminase (alanine aminotransferase) 2
Horse(100056741) glutamic pyruvate transaminase (alanine aminotransferase) 2
domestic cat(101088131) glutamic pyruvate transaminase (alanine aminotransferase) 2
dog(609510) glutamic pyruvate transaminase (alanine aminotransferase) 2
chicken(415746) glutamic pyruvate transaminase (alanine aminotransferase) 2
Thale Cress(842477) glucose-6-phosphate/phosphate translocator 2
domestic guinea pig(100724098) glutamic pyruvate transaminase (alanine aminotransferase) 2
naked mole-rat(101699130) glutamic pyruvate transaminase (alanine aminotransferase) 2
sheep(101109822) glutamic pyruvate transaminase (alanine aminotransferase) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7005 DL-Cycloserine crystalline human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133443 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133443 Rosetta Predictions human pricing
NM_001012057 Rosetta Predictions rat pricing
XM_001052974 Rosetta Predictions rat pricing
XM_001052975 Rosetta Predictions rat pricing
NM_173866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123519 predicted 1148
2 SASI_Hs01_00123520 predicted 1476
3 SASI_Hs01_00123521 predicted 1557
4 SASI_Hs01_00123522 predicted 1029
5 SASI_Hs01_00123523 predicted 428
6 SASI_Hs01_00123524 predicted 983
7 SASI_Hs01_00123525 predicted 871
8 SASI_Hs01_00123526 predicted 873
9 SASI_Hs01_00123527 predicted 1004
10 SASI_Hs01_00123528 predicted 1359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048222 predicted 338
2 SASI_Rn01_00048223 predicted 486
3 SASI_Rn01_00048224 predicted 1217
4 SASI_Rn01_00048225 predicted 1073
5 SASI_Rn01_00048226 predicted 951
6 SASI_Rn01_00048227 predicted 796
7 SASI_Rn01_00048228 predicted 961
8 SASI_Rn02_00200164 predicted 512
9 SASI_Rn01_00048229 predicted 855
10 SASI_Rn01_00048230 predicted 1335
11 SASI_Rn01_00048221 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270868 predicted 330
2 SASI_Rn02_00270869 predicted 1484
3 SASI_Rn02_00270870 predicted 485
4 SASI_Rn02_00270871 predicted 1218
5 SASI_Rn02_00270872 predicted 1078
6 SASI_Rn02_00270873 predicted 511
7 SASI_Rn02_00270874 predicted 1171
8 SASI_Rn02_00270875 predicted 1486
9 SASI_Rn02_00270876 predicted 1336
10 SASI_Rn02_00270877 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270878 predicted 330
2 SASI_Rn02_00270879 predicted 486
3 SASI_Rn02_00270880 predicted 1219
4 SASI_Rn02_00270881 predicted 1071
5 SASI_Rn02_00270882 predicted 949
6 SASI_Rn02_00270883 predicted 801
7 SASI_Rn02_00270884 predicted 961
8 SASI_Rn02_00270885 predicted 514
9 SASI_Rn02_00270886 predicted 851
10 SASI_Rn02_00270887 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155023 predicted 553
2 SASI_Mm01_00155024 predicted 555
3 SASI_Mm01_00155031 predicted 522
4 SASI_Mm01_00155032 predicted 1281
5 SASI_Mm02_00345459 predicted 1026
6 SASI_Mm02_00345460 predicted 1035
7 SASI_Mm02_00345461 predicted 1147
8 SASI_Mm02_00345462 predicted 799
9 SASI_Mm02_00345463 predicted 922
10 SASI_Mm01_00155027 predicted 656
11 SASI_Mm01_00155025 predicted 790
12 SASI_Mm01_00155026 predicted 988
13 SASI_Mm01_00155028 predicted 1621
14 SASI_Mm01_00155029 predicted 1261
15 SASI_Mm01_00155030 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173866
VALIDATED
GPT2 MISSION shRNA Bacterial Glycerol Stock
glutamic pyruvate transaminase (alanine aminotransferase) 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-1581s21c1
Sequence:CCGGATTCTCCCTCCGGTGGATAAACTCGAGTTTATCCACCGGAGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-443s21c1
Sequence:CCGGCACCTACCCAAACCTACTAAACTCGAGTTTAGTAGGTTTGGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-1023s21c1
Sequence:CCGGTGCAGATTCCACTCGTTTAAGCTCGAGCTTAAACGAGTGGAATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-775s21c1
Sequence:CCGGCGGTGCAGGTCAACTACTATCCTCGAGGATAGTAGTTGACCTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173866.3-3134s21c1
Sequence:CCGGGGAGTAGAGGGTTAGTATTTACTCGAGTAAATACTAACCCTCTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173866.1-873s1c1
Sequence:CCGGCCCTAAAGTTCTCTGCATTATCTCGAGATAATGCAGAGAACTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173866.1-1614s1c1
Sequence:CCGGGCTCCACAAGGTGAAAGACTTCTCGAGAAGTCTTTCACCTTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173866.1-3017s1c1
Sequence:CCGGGCTAGGCATATAATCCAGATACTCGAGTATCTGGATTATATGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173866.1-660s1c1
Sequence:CCGGCGGTATTTCTACAATCCTGAACTCGAGTTCAGGATTGTAGAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173866.1-626s1c1
Sequence:CCGGCAGACAACATTTACCTGACTACTCGAGTAGTCAGGTAAATGTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173866
VALIDATED
GPT2 MISSION shRNA shRNA Plasmid DNA
glutamic pyruvate transaminase (alanine aminotransferase) 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-1581s21c1
Sequence:CCGGATTCTCCCTCCGGTGGATAAACTCGAGTTTATCCACCGGAGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-443s21c1
Sequence:CCGGCACCTACCCAAACCTACTAAACTCGAGTTTAGTAGGTTTGGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-1023s21c1
Sequence:CCGGTGCAGATTCCACTCGTTTAAGCTCGAGCTTAAACGAGTGGAATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-775s21c1
Sequence:CCGGCGGTGCAGGTCAACTACTATCCTCGAGGATAGTAGTTGACCTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173866.3-3134s21c1
Sequence:CCGGGGAGTAGAGGGTTAGTATTTACTCGAGTAAATACTAACCCTCTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173866.1-873s1c1
Sequence:CCGGCCCTAAAGTTCTCTGCATTATCTCGAGATAATGCAGAGAACTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173866.1-1614s1c1
Sequence:CCGGGCTCCACAAGGTGAAAGACTTCTCGAGAAGTCTTTCACCTTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173866.1-3017s1c1
Sequence:CCGGGCTAGGCATATAATCCAGATACTCGAGTATCTGGATTATATGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173866.1-660s1c1
Sequence:CCGGCGGTATTTCTACAATCCTGAACTCGAGTTCAGGATTGTAGAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173866.1-626s1c1
Sequence:CCGGCAGACAACATTTACCTGACTACTCGAGTAGTCAGGTAAATGTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173866
VALIDATED
GPT2 MISSION shRNA Lentiviral Transduction Particles
glutamic pyruvate transaminase (alanine aminotransferase) 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-1581s21c1
Sequence:CCGGATTCTCCCTCCGGTGGATAAACTCGAGTTTATCCACCGGAGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-443s21c1
Sequence:CCGGCACCTACCCAAACCTACTAAACTCGAGTTTAGTAGGTTTGGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-1023s21c1
Sequence:CCGGTGCAGATTCCACTCGTTTAAGCTCGAGCTTAAACGAGTGGAATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173866.3-775s21c1
Sequence:CCGGCGGTGCAGGTCAACTACTATCCTCGAGGATAGTAGTTGACCTGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173866.3-3134s21c1
Sequence:CCGGGGAGTAGAGGGTTAGTATTTACTCGAGTAAATACTAACCCTCTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173866.1-873s1c1
Sequence:CCGGCCCTAAAGTTCTCTGCATTATCTCGAGATAATGCAGAGAACTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173866.1-1614s1c1
Sequence:CCGGGCTCCACAAGGTGAAAGACTTCTCGAGAAGTCTTTCACCTTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119732    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173866.1-3017s1c1
Sequence:CCGGGCTAGGCATATAATCCAGATACTCGAGTATCTGGATTATATGCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173866.1-660s1c1
Sequence:CCGGCGGTATTTCTACAATCCTGAACTCGAGTTCAGGATTGTAGAAATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173866.1-626s1c1
Sequence:CCGGCAGACAACATTTACCTGACTACTCGAGTAGTCAGGTAAATGTTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133443
VALIDATED
GPT2 MISSION shRNA Bacterial Glycerol Stock
glutamic pyruvate transaminase (alanine aminotransferase) 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-939s21c1
Sequence:CCGGTAGAAGATGTGATCCACTTTGCTCGAGCAAAGTGGATCACATCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133443.1-3275s21c1
Sequence:CCGGTGCTTGCTGTGTGGTATATAACTCGAGTTATATACCACACAGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-1565s21c1
Sequence:CCGGTACCACTTCAGGATGACTATCCTCGAGGATAGTCATCCTGAAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-875s21c1
Sequence:CCGGCCTAAGGTGCTCTGCATAATCCTCGAGGATTATGCAGAGCACCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-773s21c1
Sequence:CCGGGACGCCATCCAGGTGAATTACCTCGAGGTAATTCACCTGGATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_133443.1-661s1c1
Sequence:CCGGCGGCATTTCTACGATCCTGAACTCGAGTTCAGGATCGTAGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_133443.1-1465s1c1
Sequence:CCGGCCATCAAATGGCTCCAGACATCTCGAGATGTCTGGAGCCATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133443.1-886s1c1
Sequence:CCGGCTGCATAATCAACCCTGGGAACTCGAGTTCCCAGGGTTGATTATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_133443.1-1004s1c1
Sequence:CCGGGACAACGTGTACTCTCCAGATCTCGAGATCTGGAGAGTACACGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133443.1-1636s1c1
Sequence:CCGGCCACATCAACTTCCTGGAGAACTCGAGTTCTCCAGGAAGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133443
VALIDATED
GPT2 MISSION shRNA shRNA Plasmid DNA
glutamic pyruvate transaminase (alanine aminotransferase) 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-939s21c1
Sequence:CCGGTAGAAGATGTGATCCACTTTGCTCGAGCAAAGTGGATCACATCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133443.1-3275s21c1
Sequence:CCGGTGCTTGCTGTGTGGTATATAACTCGAGTTATATACCACACAGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-1565s21c1
Sequence:CCGGTACCACTTCAGGATGACTATCCTCGAGGATAGTCATCCTGAAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-875s21c1
Sequence:CCGGCCTAAGGTGCTCTGCATAATCCTCGAGGATTATGCAGAGCACCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-773s21c1
Sequence:CCGGGACGCCATCCAGGTGAATTACCTCGAGGTAATTCACCTGGATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_133443.1-661s1c1
Sequence:CCGGCGGCATTTCTACGATCCTGAACTCGAGTTCAGGATCGTAGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_133443.1-1465s1c1
Sequence:CCGGCCATCAAATGGCTCCAGACATCTCGAGATGTCTGGAGCCATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133443.1-886s1c1
Sequence:CCGGCTGCATAATCAACCCTGGGAACTCGAGTTCCCAGGGTTGATTATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_133443.1-1004s1c1
Sequence:CCGGGACAACGTGTACTCTCCAGATCTCGAGATCTGGAGAGTACACGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133443.1-1636s1c1
Sequence:CCGGCCACATCAACTTCCTGGAGAACTCGAGTTCTCCAGGAAGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133443
VALIDATED
GPT2 MISSION shRNA Lentiviral Transduction Particles
glutamic pyruvate transaminase (alanine aminotransferase) 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-939s21c1
Sequence:CCGGTAGAAGATGTGATCCACTTTGCTCGAGCAAAGTGGATCACATCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133443.1-3275s21c1
Sequence:CCGGTGCTTGCTGTGTGGTATATAACTCGAGTTATATACCACACAGCAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-1565s21c1
Sequence:CCGGTACCACTTCAGGATGACTATCCTCGAGGATAGTCATCCTGAAGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-875s21c1
Sequence:CCGGCCTAAGGTGCTCTGCATAATCCTCGAGGATTATGCAGAGCACCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133443.1-773s21c1
Sequence:CCGGGACGCCATCCAGGTGAATTACCTCGAGGTAATTCACCTGGATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_133443.1-661s1c1
Sequence:CCGGCGGCATTTCTACGATCCTGAACTCGAGTTCAGGATCGTAGAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_133443.1-1465s1c1
Sequence:CCGGCCATCAAATGGCTCCAGACATCTCGAGATGTCTGGAGCCATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133443.1-886s1c1
Sequence:CCGGCTGCATAATCAACCCTGGGAACTCGAGTTCCCAGGGTTGATTATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_133443.1-1004s1c1
Sequence:CCGGGACAACGTGTACTCTCCAGATCTCGAGATCTGGAGAGTACACGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133443.1-1636s1c1
Sequence:CCGGCCACATCAACTTCCTGGAGAACTCGAGTTCTCCAGGAAGTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks