EMAIL THIS PAGE TO A FRIEND

GPT

glutamic-pyruvate transaminase (alanine aminotransferase)

60 Gene Product Result for
Synonyms: AAT1 ALT1 GPT1
UniProtKB ID: P24298, B0YJ18, D3DWM7, P78398, Q93076
Gene ID:
Human(2875) Summary: This gene encodes cytosolic alanine aminotransaminase 1 (ALT1); also known as glutamate-pyruvate transaminase 1. This enzyme catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate pyruvate and glutamate and, therefore, plays a key role in the intermediary metabolism of glucose and amino acids. Serum activity levels of this enzyme are routinely used as a biomarker of liver injury caused by drug toxicity, infection, alcohol, and steatosis. A related gene on chromosome 16 encodes a putative mitochondrial alanine aminotransaminase.[provided by RefSeq, Nov 2009]
Mouse(76282) glutamic pyruvic transaminase, soluble
Rat(81670) glutamic-pyruvate transaminase (alanine aminotransferase)
sheep(101110488) glutamic-pyruvate transaminase (alanine aminotransferase)
sheep(100286806) glutamic-pyruvate transaminase (alanine aminotransferase)
domestic guinea pig(100716607) glutamic-pyruvate transaminase (alanine aminotransferase)
naked mole-rat(101713635) glutamic-pyruvate transaminase (alanine aminotransferase)
fruit fly(5656924) Glutamate pyruvate transaminase
Thale Cress(818747) UDP-GlcNAc:dolichol phosphate N-acetylglucosamine-1-phosphate transferase
cow(539188) glutamic-pyruvate transaminase (alanine aminotransferase)
domestic cat(101097207) glutamic-pyruvate transaminase (alanine aminotransferase)
dog(609914) glutamic-pyruvate transaminase (alanine aminotransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7005 DL-Cycloserine crystalline human pricing

Kits

Product # Description Species Add to Cart
 
MAK052 ALT Activity Assay sufficient for 100 colorimetric or fluorometric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005309 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005309 Rosetta Predictions human pricing
NM_031039 Rosetta Predictions rat pricing
NM_182805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064821 predicted 1191
2 SASI_Hs01_00064822 predicted 1010
3 SASI_Hs01_00064823 predicted 475
4 SASI_Hs01_00064824 predicted 988
5 SASI_Hs01_00064825 predicted 1068
6 SASI_Hs01_00064826 predicted 482
7 SASI_Hs01_00064827 predicted 1000
8 SASI_Hs01_00064828 predicted 1069
9 SASI_Hs01_00064829 predicted 488
10 SASI_Hs02_00339374 predicted 454
11 SASI_Hs01_00064820 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093831 predicted 585
2 SASI_Rn01_00093832 predicted 508
3 SASI_Rn01_00093833 predicted 666
4 SASI_Rn01_00093834 predicted 643
5 SASI_Rn01_00093835 predicted 1488
6 SASI_Rn02_00264258 predicted 1022
7 SASI_Rn01_00093838 predicted 723
8 SASI_Rn02_00264259 predicted 642
9 SASI_Rn02_00264260 predicted 555
10 SASI_Rn02_00264261 predicted 1408
11 SASI_Rn01_00093829 predicted 1342
12 SASI_Rn01_00093830 predicted 1083
13 SASI_Rn01_00093836 predicted 921
14 SASI_Rn01_00093837 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349972 predicted 545
2 SASI_Mm01_00124537 predicted 654
3 SASI_Mm01_00124538 predicted 501
4 SASI_Mm01_00124539 predicted 1404
5 SASI_Mm02_00349973 predicted 1333
6 SASI_Mm01_00124541 predicted 1480
7 SASI_Mm01_00124542 predicted 1070
8 SASI_Mm01_00124543 predicted 481
9 SASI_Mm01_00124544 predicted 1017
10 SASI_Mm01_00124545 predicted 1025
11 SASI_Mm01_00124540 predicted 873
12 SASI_Mm01_00124546 predicted 715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182805
GPT MISSION shRNA Bacterial Glycerol Stock
glutamic-pyruvate transaminase (alanine aminotransferase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182805.1-1631s1c1
Sequence:CCGGCTCAACAAACTGAGGGTCCTTCTCGAGAAGGACCCTCAGTTTGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-550s1c1
Sequence:CCGGGCAGACCCGAACAACATATTTCTCGAGAAATATGTTGTTCGGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-1336s1c1
Sequence:CCGGGCTATGTATTCCTTCCCTCAACTCGAGTTGAGGGAAGGAATACATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-1555s1c1
Sequence:CCGGCTGAGGCACTTCCATGCTAAACTCGAGTTTAGCATGGAAGTGCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-287s1c1
Sequence:CCGGCTGAGGTTATCCGTGCCAATACTCGAGTATTGGCACGGATAACCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-860s21c1
Sequence:CCGGTGAATGCATCGAGGCCGTAATCTCGAGATTACGGCCTCGATGCATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-1481s21c1
Sequence:CCGGGCAGGAGGGCACCTATCATTTCTCGAGAAATGATAGGTGCCCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182805.2-1613s21c1
Sequence:CCGGCACTGGATGCTCTCTGACTCACTCGAGTGAGTCAGAGAGCATCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-289s21c1
Sequence:CCGGAGGTTATCCGTGCCAATATTGCTCGAGCAATATTGGCACGGATAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-504s21c1
Sequence:CCGGGAGGATGTGGCGCAATATATTCTCGAGAATATATTGCGCCACATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182805
GPT MISSION shRNA shRNA Plasmid DNA
glutamic-pyruvate transaminase (alanine aminotransferase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182805.1-1631s1c1
Sequence:CCGGCTCAACAAACTGAGGGTCCTTCTCGAGAAGGACCCTCAGTTTGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-550s1c1
Sequence:CCGGGCAGACCCGAACAACATATTTCTCGAGAAATATGTTGTTCGGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-1336s1c1
Sequence:CCGGGCTATGTATTCCTTCCCTCAACTCGAGTTGAGGGAAGGAATACATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-1555s1c1
Sequence:CCGGCTGAGGCACTTCCATGCTAAACTCGAGTTTAGCATGGAAGTGCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-287s1c1
Sequence:CCGGCTGAGGTTATCCGTGCCAATACTCGAGTATTGGCACGGATAACCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-860s21c1
Sequence:CCGGTGAATGCATCGAGGCCGTAATCTCGAGATTACGGCCTCGATGCATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-1481s21c1
Sequence:CCGGGCAGGAGGGCACCTATCATTTCTCGAGAAATGATAGGTGCCCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182805.2-1613s21c1
Sequence:CCGGCACTGGATGCTCTCTGACTCACTCGAGTGAGTCAGAGAGCATCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-289s21c1
Sequence:CCGGAGGTTATCCGTGCCAATATTGCTCGAGCAATATTGGCACGGATAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-504s21c1
Sequence:CCGGGAGGATGTGGCGCAATATATTCTCGAGAATATATTGCGCCACATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182805
GPT MISSION shRNA Lentiviral Transduction Particles
glutamic-pyruvate transaminase (alanine aminotransferase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182805.1-1631s1c1
Sequence:CCGGCTCAACAAACTGAGGGTCCTTCTCGAGAAGGACCCTCAGTTTGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-550s1c1
Sequence:CCGGGCAGACCCGAACAACATATTTCTCGAGAAATATGTTGTTCGGGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-1336s1c1
Sequence:CCGGGCTATGTATTCCTTCCCTCAACTCGAGTTGAGGGAAGGAATACATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-1555s1c1
Sequence:CCGGCTGAGGCACTTCCATGCTAAACTCGAGTTTAGCATGGAAGTGCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182805.1-287s1c1
Sequence:CCGGCTGAGGTTATCCGTGCCAATACTCGAGTATTGGCACGGATAACCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-860s21c1
Sequence:CCGGTGAATGCATCGAGGCCGTAATCTCGAGATTACGGCCTCGATGCATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-1481s21c1
Sequence:CCGGGCAGGAGGGCACCTATCATTTCTCGAGAAATGATAGGTGCCCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182805.2-1613s21c1
Sequence:CCGGCACTGGATGCTCTCTGACTCACTCGAGTGAGTCAGAGAGCATCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-289s21c1
Sequence:CCGGAGGTTATCCGTGCCAATATTGCTCGAGCAATATTGGCACGGATAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182805.2-504s21c1
Sequence:CCGGGAGGATGTGGCGCAATATATTCTCGAGAATATATTGCGCCACATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005309
VALIDATED
GPT MISSION shRNA Bacterial Glycerol Stock
glutamic-pyruvate transaminase (alanine aminotransferase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-1119s1c1
Sequence:CCGGGCAGTTCCACTCATTCAAGAACTCGAGTTCTTGAATGAGTGGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-1716s1c1
Sequence:CCGGGCTGAGCAGGTTCCATGCCAACTCGAGTTGGCATGGAACCTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_005309.1-1128s1c1
Sequence:CCGGCTCATTCAAGAAGGTGCTCATCTCGAGATGAGCACCTTCTTGAATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-438s1c1
Sequence:CCGGGAAGCCTTTCACCGAGGTCATCTCGAGATGACCTCGGTGAAAGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-529s1c1
Sequence:CCGGCTCTGTGTTAACCCTGATCTTCTCGAGAAGATCAGGGTTAACACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1400s21c1
Sequence:CCGGACCGAGCAGGTCTTCAATGAGCTCGAGCTCATTGAAGACCTGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1009s21c1
Sequence:CCGGCTTCGAAGAGCGGCTCTTTCTCTCGAGAGAAAGAGCCGCTCTTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1616s21c1
Sequence:CCGGCACTTCCGGATGACCATTCTGCTCGAGCAGAATGGTCATCCGGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1070s21c1
Sequence:CCGGGGTTCGCAGTTCCACTCATTCCTCGAGGAATGAGTGGAACTGCGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-824s21c1
Sequence:CCGGGCAGTGCAGGTGGATTACTACCTCGAGGTAGTAATCCACCTGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005309
VALIDATED
GPT MISSION shRNA shRNA Plasmid DNA
glutamic-pyruvate transaminase (alanine aminotransferase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-1119s1c1
Sequence:CCGGGCAGTTCCACTCATTCAAGAACTCGAGTTCTTGAATGAGTGGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-1716s1c1
Sequence:CCGGGCTGAGCAGGTTCCATGCCAACTCGAGTTGGCATGGAACCTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_005309.1-1128s1c1
Sequence:CCGGCTCATTCAAGAAGGTGCTCATCTCGAGATGAGCACCTTCTTGAATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-438s1c1
Sequence:CCGGGAAGCCTTTCACCGAGGTCATCTCGAGATGACCTCGGTGAAAGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-529s1c1
Sequence:CCGGCTCTGTGTTAACCCTGATCTTCTCGAGAAGATCAGGGTTAACACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1400s21c1
Sequence:CCGGACCGAGCAGGTCTTCAATGAGCTCGAGCTCATTGAAGACCTGCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1009s21c1
Sequence:CCGGCTTCGAAGAGCGGCTCTTTCTCTCGAGAGAAAGAGCCGCTCTTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1616s21c1
Sequence:CCGGCACTTCCGGATGACCATTCTGCTCGAGCAGAATGGTCATCCGGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1070s21c1
Sequence:CCGGGGTTCGCAGTTCCACTCATTCCTCGAGGAATGAGTGGAACTGCGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-824s21c1
Sequence:CCGGGCAGTGCAGGTGGATTACTACCTCGAGGTAGTAATCCACCTGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005309
VALIDATED
GPT MISSION shRNA Lentiviral Transduction Particles
glutamic-pyruvate transaminase (alanine aminotransferase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-1119s1c1
Sequence:CCGGGCAGTTCCACTCATTCAAGAACTCGAGTTCTTGAATGAGTGGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-1716s1c1
Sequence:CCGGGCTGAGCAGGTTCCATGCCAACTCGAGTTGGCATGGAACCTGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_005309.1-1128s1c1
Sequence:CCGGCTCATTCAAGAAGGTGCTCATCTCGAGATGAGCACCTTCTTGAATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-438s1c1
Sequence:CCGGGAAGCCTTTCACCGAGGTCATCTCGAGATGACCTCGGTGAAAGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005309.1-529s1c1
Sequence:CCGGCTCTGTGTTAACCCTGATCTTCTCGAGAAGATCAGGGTTAACACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1400s21c1
Sequence:CCGGACCGAGCAGGTCTTCAATGAGCTCGAGCTCATTGAAGACCTGCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1009s21c1
Sequence:CCGGCTTCGAAGAGCGGCTCTTTCTCTCGAGAGAAAGAGCCGCTCTTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1616s21c1
Sequence:CCGGCACTTCCGGATGACCATTCTGCTCGAGCAGAATGGTCATCCGGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-1070s21c1
Sequence:CCGGGGTTCGCAGTTCCACTCATTCCTCGAGGAATGAGTGGAACTGCGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005309.2-824s21c1
Sequence:CCGGGCAGTGCAGGTGGATTACTACCTCGAGGTAGTAATCCACCTGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)