EMAIL THIS PAGE TO A FRIEND

GPX1

glutathione peroxidase 1

Synonyms: GPXD GSHPX1
UniProtKB ID: P07203, E9PAS1, Q7Z5H1, Q9BW12
Gene ID:
Human(2876) Summary: This gene encodes a member of the glutathione peroxidase family. Glutathione peroxidase functions in the detoxification of hydrogen peroxide, and is one of the most important antioxidant enzymes in humans. This protein is one of only a few proteins known in higher vertebrates to contain selenocysteine, which occurs at the active site of glutathione peroxidase and is coded by UGA, that normally functions as a translation termination codon. In addition, this protein is characterized in a polyalanine sequence polymorphism in the N-terminal region, which includes three alleles with five, six or seven alanine (ALA) repeats in this sequence. The allele with five ALA repeats is significantly associated with breast cancer risk. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14775) glutathione peroxidase 1
Rat(24404) glutathione peroxidase 1
Thale Cress(817046) phospholipid hydroperoxide glutathione peroxidase 1
chicken(100857115) glutathione peroxidase 1
domestic cat(101083751) glutathione peroxidase 1
cow(281209) glutathione peroxidase 1
Horse(100053396) glutathione peroxidase 1
dog(442961) glutathione peroxidase 1
sheep(100820742) glutathione peroxidase 1
Domestic Rabbit(100009258) glutathione peroxidase 1
domestic guinea pig(100729115) glutathione peroxidase 1
naked mole-rat(101710466) glutathione peroxidase 1
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000581 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218531 MISSION® esiRNA esiRNA targeting human GPX1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000581 Rosetta Predictions human pricing
NM_201397 Rosetta Predictions human pricing
NM_030826 Rosetta Predictions rat pricing
NM_008160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240786 predicted 640
2 SASI_Hs01_00240787 predicted 632
3 SASI_Hs01_00240788 predicted 541
4 SASI_Hs01_00240789 predicted 619
5 SASI_Hs02_00302842 predicted 616
6 SASI_Hs01_00240791 predicted 544
7 SASI_Hs01_00240792 predicted 615
8 SASI_Hs01_00240793 predicted 531
9 SASI_Hs01_00240794 predicted 533
10 SASI_Hs01_00240795 predicted 616
11 SASI_Hs01_00240790 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372929 predicted 814
2 SASI_Hs01_00095458 predicted 825
3 SASI_Hs01_00095459 predicted 824
4 SASI_Hs01_00095460 predicted 811
5 SASI_Hs01_00095461 predicted 807
6 SASI_Hs01_00095463 predicted 673
7 SASI_Hs01_00095464 predicted 489
8 SASI_Hs01_00095465 predicted 456
9 SASI_Hs01_00095467 predicted 186
10 SASI_Hs02_00372930 predicted 186
11 SASI_Hs01_00095462 predicted 440
12 SASI_Hs01_00095466 predicted 240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031954 predicted 284
2 SASI_Rn01_00031955 predicted 605
3 SASI_Rn01_00031956 predicted 603
4 SASI_Rn01_00031957 predicted 466
5 SASI_Rn02_00264032 predicted 521
6 SASI_Rn01_00031959 predicted 432
7 SASI_Rn01_00031960 predicted 575
8 SASI_Rn01_00031961 predicted 616
9 SASI_Rn01_00031962 predicted 374
10 SASI_Rn01_00031963 predicted 612
11 SASI_Rn01_00031958 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313264 predicted 247
2 SASI_Mm02_00313265 predicted 250
3 SASI_Mm02_00313266 predicted 250
4 SASI_Mm01_00121942 predicted 231
5 SASI_Mm01_00121943 predicted 546
6 SASI_Mm01_00121944 predicted 575
7 SASI_Mm01_00121945 predicted 259
8 SASI_Mm01_00121947 predicted 582
9 SASI_Mm01_00121948 predicted 504
10 SASI_Mm01_00121949 predicted 556
11 SASI_Mm01_00121946 predicted 409
12 SASI_Mm01_00121950 predicted 572
13 SASI_Mm01_00121951 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000581
VALIDATED
GPX1 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-190s1c1
Sequence:CCGGGCAAGGTACTACTTATCGAGACTCGAGTCTCGATAAGTAGTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-309s1c1
Sequence:CCGGCCGTGCAACCAGTTTGGGCATCTCGAGATGCCCAAACTGGTTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-413s1c1
Sequence:CCGGCTTCGAGAAGTGCGAGGTGAACTCGAGTTCACCTCGCACTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000581.2-562s1c1
Sequence:CCGGCCTGGAACTTTGAGAAGTTCCCTCGAGGGAACTTCTCAAAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-326s1c1
Sequence:CCGGGCATCAGGAGAACGCCAAGAACTCGAGTTCTTGGCGTTCTCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-640s21c1
Sequence:CCGGACATCGAGCCTGACATCGAAGCTCGAGCTTCGATGTCAGGCTCGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-190s21c1
Sequence:CCGGGCAAGGTACTACTTATCGAGACTCGAGTCTCGATAAGTAGTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-326s21c1
Sequence:CCGGGCATCAGGAGAACGCCAAGAACTCGAGTTCTTGGCGTTCTCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-341s21c1
Sequence:CCGGCAAGAACGAAGAGATTCTGAACTCGAGTTCAGAATCTCTTCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-623s21c1
Sequence:CCGGCCGCTTCCAGACCATTGACATCTCGAGATGTCAATGGTCTGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-245s21c1
Sequence:CCGGCTACACCCAGATGAACGAGCTCTCGAGAGCTCGTTCATCTGGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-401s21c1
Sequence:CCGGCAACTTCATGCTCTTCGAGAACTCGAGTTCTCGAAGAGCATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000581
VALIDATED
GPX1 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-190s1c1
Sequence:CCGGGCAAGGTACTACTTATCGAGACTCGAGTCTCGATAAGTAGTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-309s1c1
Sequence:CCGGCCGTGCAACCAGTTTGGGCATCTCGAGATGCCCAAACTGGTTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-413s1c1
Sequence:CCGGCTTCGAGAAGTGCGAGGTGAACTCGAGTTCACCTCGCACTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000581.2-562s1c1
Sequence:CCGGCCTGGAACTTTGAGAAGTTCCCTCGAGGGAACTTCTCAAAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-326s1c1
Sequence:CCGGGCATCAGGAGAACGCCAAGAACTCGAGTTCTTGGCGTTCTCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-640s21c1
Sequence:CCGGACATCGAGCCTGACATCGAAGCTCGAGCTTCGATGTCAGGCTCGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-190s21c1
Sequence:CCGGGCAAGGTACTACTTATCGAGACTCGAGTCTCGATAAGTAGTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-326s21c1
Sequence:CCGGGCATCAGGAGAACGCCAAGAACTCGAGTTCTTGGCGTTCTCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-341s21c1
Sequence:CCGGCAAGAACGAAGAGATTCTGAACTCGAGTTCAGAATCTCTTCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-623s21c1
Sequence:CCGGCCGCTTCCAGACCATTGACATCTCGAGATGTCAATGGTCTGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-245s21c1
Sequence:CCGGCTACACCCAGATGAACGAGCTCTCGAGAGCTCGTTCATCTGGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-401s21c1
Sequence:CCGGCAACTTCATGCTCTTCGAGAACTCGAGTTCTCGAAGAGCATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000581
VALIDATED
GPX1 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-190s1c1
Sequence:CCGGGCAAGGTACTACTTATCGAGACTCGAGTCTCGATAAGTAGTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-309s1c1
Sequence:CCGGCCGTGCAACCAGTTTGGGCATCTCGAGATGCCCAAACTGGTTGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-413s1c1
Sequence:CCGGCTTCGAGAAGTGCGAGGTGAACTCGAGTTCACCTCGCACTTCTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000581.2-562s1c1
Sequence:CCGGCCTGGAACTTTGAGAAGTTCCCTCGAGGGAACTTCTCAAAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000581.2-326s1c1
Sequence:CCGGGCATCAGGAGAACGCCAAGAACTCGAGTTCTTGGCGTTCTCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-640s21c1
Sequence:CCGGACATCGAGCCTGACATCGAAGCTCGAGCTTCGATGTCAGGCTCGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-190s21c1
Sequence:CCGGGCAAGGTACTACTTATCGAGACTCGAGTCTCGATAAGTAGTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-326s21c1
Sequence:CCGGGCATCAGGAGAACGCCAAGAACTCGAGTTCTTGGCGTTCTCCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-341s21c1
Sequence:CCGGCAAGAACGAAGAGATTCTGAACTCGAGTTCAGAATCTCTTCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-623s21c1
Sequence:CCGGCCGCTTCCAGACCATTGACATCTCGAGATGTCAATGGTCTGGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-245s21c1
Sequence:CCGGCTACACCCAGATGAACGAGCTCTCGAGAGCTCGTTCATCTGGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000581.2-401s21c1
Sequence:CCGGCAACTTCATGCTCTTCGAGAACTCGAGTTCTCGAAGAGCATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008160
VALIDATED
GPX1 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008160.1-724s1c1
Sequence:CCGGGCACGGAGAAACACCTGATTTCTCGAGAAATCAGGTGTTTCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008160.1-470s1c1
Sequence:CCGGCCCAAGTACATCATTTGGTCTCTCGAGAGACCAAATGATGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008160.1-277s1c1
Sequence:CCGGACACCAGGAGAATGGCAAGAACTCGAGTTCTTGCCATTCTCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008160.1-190s1c1
Sequence:CCGGCCGGGACTACACCGAGATGAACTCGAGTTCATCTCGGTGTAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-190s21c1
Sequence:CCGGCCGGGACTACACCGAGATGAACTCGAGTTCATCTCGGTGTAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008160.1-364s1c2
Sequence:CCGGGTTTGAGAAGTGCGAAGTGAACTCGAGTTCACTTCGCACTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-277s21c1
Sequence:CCGGACACCAGGAGAATGGCAAGAACTCGAGTTCTTGCCATTCTCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-364s21c1
Sequence:CCGGGTTTGAGAAGTGCGAAGTGAACTCGAGTTCACTTCGCACTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-651s21c1
Sequence:CCGGCTGGCATTGGCTTGGTGATTACTCGAGTAATCACCAAGCCAATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008160
VALIDATED
GPX1 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008160.1-724s1c1
Sequence:CCGGGCACGGAGAAACACCTGATTTCTCGAGAAATCAGGTGTTTCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008160.1-470s1c1
Sequence:CCGGCCCAAGTACATCATTTGGTCTCTCGAGAGACCAAATGATGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008160.1-277s1c1
Sequence:CCGGACACCAGGAGAATGGCAAGAACTCGAGTTCTTGCCATTCTCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008160.1-190s1c1
Sequence:CCGGCCGGGACTACACCGAGATGAACTCGAGTTCATCTCGGTGTAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-190s21c1
Sequence:CCGGCCGGGACTACACCGAGATGAACTCGAGTTCATCTCGGTGTAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008160.1-364s1c2
Sequence:CCGGGTTTGAGAAGTGCGAAGTGAACTCGAGTTCACTTCGCACTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-277s21c1
Sequence:CCGGACACCAGGAGAATGGCAAGAACTCGAGTTCTTGCCATTCTCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-364s21c1
Sequence:CCGGGTTTGAGAAGTGCGAAGTGAACTCGAGTTCACTTCGCACTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-651s21c1
Sequence:CCGGCTGGCATTGGCTTGGTGATTACTCGAGTAATCACCAAGCCAATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008160
VALIDATED
GPX1 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008160.1-724s1c1
Sequence:CCGGGCACGGAGAAACACCTGATTTCTCGAGAAATCAGGTGTTTCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008160.1-470s1c1
Sequence:CCGGCCCAAGTACATCATTTGGTCTCTCGAGAGACCAAATGATGTACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008160.1-277s1c1
Sequence:CCGGACACCAGGAGAATGGCAAGAACTCGAGTTCTTGCCATTCTCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008160.1-190s1c1
Sequence:CCGGCCGGGACTACACCGAGATGAACTCGAGTTCATCTCGGTGTAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-190s21c1
Sequence:CCGGCCGGGACTACACCGAGATGAACTCGAGTTCATCTCGGTGTAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008160.1-364s1c2
Sequence:CCGGGTTTGAGAAGTGCGAAGTGAACTCGAGTTCACTTCGCACTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-277s21c1
Sequence:CCGGACACCAGGAGAATGGCAAGAACTCGAGTTCTTGCCATTCTCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-364s21c1
Sequence:CCGGGTTTGAGAAGTGCGAAGTGAACTCGAGTTCACTTCGCACTTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008160.5-651s21c1
Sequence:CCGGCTGGCATTGGCTTGGTGATTACTCGAGTAATCACCAAGCCAATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks