EMAIL THIS PAGE TO A FRIEND

GPX2

glutathione peroxidase 2 (gastrointestinal)

72 Gene Product Result for
Synonyms: GI-GPx GPRP GPRP-2 GPx-2 GPx-GI GSHPX-GI GSHPx-2
UniProtKB ID: P18283, Q6PJ52, Q8WWI7, Q9NRP9
Gene ID:
Human(2877) Summary: This gene is a member of the glutathione peroxidase family and encodes a selenium-dependent glutathione peroxidase that is one of two isoenzymes responsible for the majority of the glutathione-dependent hydrogen peroxide-reducing activity in the epithelium of the gastrointestinal tract. The protein encoded by this locus contains a selenocysteine (Sec) residue encoded by the UGA codon, which normally signals translation termination. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
Mouse(14776) glutathione peroxidase 2
Rat(29326) glutathione peroxidase 2
Thale Cress(817715) glutathione peroxidase GPx
domestic cat(101089019) glutathione peroxidase 2 (gastrointestinal)
cow(533088) glutathione peroxidase 2 (gastrointestinal)
Horse(100146145) glutathione peroxidase 2 (gastrointestinal)
dog(480356) glutathione peroxidase 2 (gastrointestinal)
chicken(100857454) glutathione peroxidase 2 (gastrointestinal)
domestic guinea pig(100714682) glutathione peroxidase 2 (gastrointestinal)
naked mole-rat(101701418) glutathione peroxidase 2 (gastrointestinal)
sheep(101110596) glutathione peroxidase 2 (gastrointestinal)
Domestic Rabbit(100355002) glutathione peroxidase 2 (gastrointestinal)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002083 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030677 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030677 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030677 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047641 MISSION® esiRNA esiRNA human GPX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002083 Rosetta Predictions human pricing
NM_183403 Rosetta Predictions rat pricing
NM_030677 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232667 predicted 454
2 SASI_Hs01_00232668 predicted 741
3 SASI_Hs01_00232669 predicted 371
4 SASI_Hs01_00232670 predicted 621
5 SASI_Hs01_00232671 predicted 318
6 SASI_Hs01_00232672 predicted 629
7 SASI_Hs01_00232673 predicted 653
8 SASI_Hs01_00232674 predicted 525
9 SASI_Hs01_00232675 predicted 605
10 SASI_Hs01_00232676 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269899 predicted 780
2 SASI_Rn01_00078445 predicted 782
3 SASI_Rn01_00078446 predicted 559
4 SASI_Rn01_00078448 predicted 719
5 SASI_Rn01_00078449 predicted 358
6 SASI_Rn02_00269900 predicted 410
7 SASI_Rn01_00078450 predicted 701
8 SASI_Rn01_00078451 predicted 626
9 SASI_Rn02_00269901 predicted 505
10 SASI_Rn01_00078452 predicted 443
11 SASI_Rn01_00078447 predicted 338
12 SASI_Rn01_00078453 predicted 709
13 SASI_Rn01_00078454 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140828 predicted 791
2 SASI_Mm01_00140829 predicted 467
3 SASI_Mm01_00140830 predicted 705
4 SASI_Mm02_00336820 predicted 515
5 SASI_Mm01_00140831 predicted 392
6 SASI_Mm02_00336821 predicted 230
7 SASI_Mm01_00140833 predicted 721
8 SASI_Mm02_00336822 predicted 411
9 SASI_Mm01_00140835 predicted 733
10 SASI_Mm01_00140836 predicted 292
11 SASI_Mm01_00140832 predicted 523
12 SASI_Mm01_00140834 predicted 676
13 SASI_Mm01_00140837 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002083
VALIDATED
GPX2 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 2 (gastrointestinal)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002083.2-407s21c1
Sequence:CCGGTGAATGGGCAGAACGAGCATCCTCGAGGATGCTCGTTCTGCCCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002083.2-829s21c1
Sequence:CCGGACCCTCTGGTTGGTGATTCAACTCGAGTTGAATCACCAACCAGAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002083.2-753s21c1
Sequence:CCGGAGCATTCCCTTGATATCAGTCCTCGAGGACTGATATCAAGGGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002083.2-458s1c1
Sequence:CCGGCCTACCCTTATGATGACCCATCTCGAGATGGGTCATCATAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002083.2-286s1c1
Sequence:CCGGCCTTGCAACCAATTTGGACATCTCGAGATGTCCAAATTGGTTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002083.2-491s1c1
Sequence:CCGGCCGATCCCAAGCTCATCATTTCTCGAGAAATGATGAGCTTGGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002083.2-625s1c1
Sequence:CCGGCCTGACATCAAGCGCCTCCTTCTCGAGAAGGAGGCGCTTGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002083.2-144s1c1
Sequence:CCGGGAAGGTAGATTTCAATACGTTCTCGAGAACGTATTGAAATCTACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002083
VALIDATED
GPX2 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 2 (gastrointestinal)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002083.2-407s21c1
Sequence:CCGGTGAATGGGCAGAACGAGCATCCTCGAGGATGCTCGTTCTGCCCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002083.2-829s21c1
Sequence:CCGGACCCTCTGGTTGGTGATTCAACTCGAGTTGAATCACCAACCAGAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002083.2-753s21c1
Sequence:CCGGAGCATTCCCTTGATATCAGTCCTCGAGGACTGATATCAAGGGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002083.2-458s1c1
Sequence:CCGGCCTACCCTTATGATGACCCATCTCGAGATGGGTCATCATAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002083.2-286s1c1
Sequence:CCGGCCTTGCAACCAATTTGGACATCTCGAGATGTCCAAATTGGTTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002083.2-491s1c1
Sequence:CCGGCCGATCCCAAGCTCATCATTTCTCGAGAAATGATGAGCTTGGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002083.2-625s1c1
Sequence:CCGGCCTGACATCAAGCGCCTCCTTCTCGAGAAGGAGGCGCTTGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002083.2-144s1c1
Sequence:CCGGGAAGGTAGATTTCAATACGTTCTCGAGAACGTATTGAAATCTACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002083
VALIDATED
GPX2 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 2 (gastrointestinal)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002083.2-407s21c1
Sequence:CCGGTGAATGGGCAGAACGAGCATCCTCGAGGATGCTCGTTCTGCCCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002083.2-829s21c1
Sequence:CCGGACCCTCTGGTTGGTGATTCAACTCGAGTTGAATCACCAACCAGAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002083.2-753s21c1
Sequence:CCGGAGCATTCCCTTGATATCAGTCCTCGAGGACTGATATCAAGGGAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002083.2-458s1c1
Sequence:CCGGCCTACCCTTATGATGACCCATCTCGAGATGGGTCATCATAAGGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002083.2-286s1c1
Sequence:CCGGCCTTGCAACCAATTTGGACATCTCGAGATGTCCAAATTGGTTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002083.2-491s1c1
Sequence:CCGGCCGATCCCAAGCTCATCATTTCTCGAGAAATGATGAGCTTGGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002083.2-625s1c1
Sequence:CCGGCCTGACATCAAGCGCCTCCTTCTCGAGAAGGAGGCGCTTGATGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002083.2-144s1c1
Sequence:CCGGGAAGGTAGATTTCAATACGTTCTCGAGAACGTATTGAAATCTACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030677
GPX2 MISSION shRNA Bacterial Glycerol Stock
glutathione peroxidase 2 (gastrointestinal)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030677.1-720s1c1
Sequence:CCGGCCCAGGAATCTCCCACTGTTTCTCGAGAAACAGTGGGAGATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-241s1c1
Sequence:CCGGCGTCACTCTGAGGAACAACTACTCGAGTAGTTGTTCCTCAGAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-421s1c1
Sequence:CCGGCCACCTTTAGTCTTACCCAAACTCGAGTTTGGGTAAGACTAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-535s1c1
Sequence:CCGGCCGATCCCAAGCTCATCATATCTCGAGATATGATGAGCTTGGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-470s1c1
Sequence:CCGGTCCTGTCTTTGCCTACCTGAACTCGAGTTCAGGTAGGCAAAGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030677
GPX2 MISSION shRNA shRNA Plasmid DNA
glutathione peroxidase 2 (gastrointestinal)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030677.1-720s1c1
Sequence:CCGGCCCAGGAATCTCCCACTGTTTCTCGAGAAACAGTGGGAGATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-241s1c1
Sequence:CCGGCGTCACTCTGAGGAACAACTACTCGAGTAGTTGTTCCTCAGAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-421s1c1
Sequence:CCGGCCACCTTTAGTCTTACCCAAACTCGAGTTTGGGTAAGACTAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-535s1c1
Sequence:CCGGCCGATCCCAAGCTCATCATATCTCGAGATATGATGAGCTTGGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-470s1c1
Sequence:CCGGTCCTGTCTTTGCCTACCTGAACTCGAGTTCAGGTAGGCAAAGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030677
GPX2 MISSION shRNA Lentiviral Transduction Particles
glutathione peroxidase 2 (gastrointestinal)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030677.1-720s1c1
Sequence:CCGGCCCAGGAATCTCCCACTGTTTCTCGAGAAACAGTGGGAGATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-241s1c1
Sequence:CCGGCGTCACTCTGAGGAACAACTACTCGAGTAGTTGTTCCTCAGAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-421s1c1
Sequence:CCGGCCACCTTTAGTCTTACCCAAACTCGAGTTTGGGTAAGACTAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-535s1c1
Sequence:CCGGCCGATCCCAAGCTCATCATATCTCGAGATATGATGAGCTTGGGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030677.1-470s1c1
Sequence:CCGGTCCTGTCTTTGCCTACCTGAACTCGAGTTCAGGTAGGCAAAGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks